-
No products found
because this supplier's products are not listed.
Mizuki Honda, et al.,
bioRxiv - Genomics 2020
Quote:
... Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) were used for the colorimetric detection of alkaline phosphatase activity ...
-
No products found
because this supplier's products are not listed.
Anne-Perrine Foray, et al.,
bioRxiv - Immunology 2021
Quote:
... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
No products found
because this supplier's products are not listed.
Maxime Leblanc Latour, et al.,
bioRxiv - Bioengineering 2020
Quote:
Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Denis Baranenko, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... Bands were detected by 5-bromo-4-chloro-3-indolyl phosphate with a nitro blue tetrazolium kit (Abcam, China) as a chemiluminescent substrate ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Chiara Camillo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Niclas Nordholt, et al.,
bioRxiv - Microbiology 2022
Quote:
... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... The membranes were washed 3 times in TBST for 15 minutes each and blots were developed with BCIP/NBT (5-bromo-4-chloro-3-indoyl-phosphate/nitro blue tetrazolium) color development substrate (VWR).
-
No products found
because this supplier's products are not listed.
Anna Gritsenko, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem.
-
No products found
because this supplier's products are not listed.
Pattama Wiriyasermkul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 50 μL of 1 mg/mL XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) (Biotium) was mixed with 5 μL of 1.5 mg/mL phenazine methosulfate ...
-
No products found
because this supplier's products are not listed.
Phillip Zhu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ole A.W. Haabeth, et al.,
bioRxiv - Immunology 2021
Quote:
... After washing wells were incubated with a 5-bromo-4-chloro-3⍰-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (R&D systems, mouse IFNγ Kit Cat # EL485). Plates were scanned and analyzed using ImmunoSpot Microanalyzer.
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Mani Gurubarath, Karthik Dhananjayan,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Tris (2-carboxyethyl)phosphine hydrochloride (TCEP) and 4-aminosulfonyl-7fluoro-2,1,3-benzoxadiazole (ABD-F) (TCI chemicals India Pvt. Limited, India). All solvents used for chromatographic analysis are of HPLC grade.
-
No products found
because this supplier's products are not listed.
Alison Dumont, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3/7 dye (4440, Sartorius, 1/1000) and/or propidium Iodide (PI ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng ml−1 recombinant human IL-7 (Peprotech) and 5 ng ml−1 IL-15 ...
-
No products found
because this supplier's products are not listed.
Rishikesh U. Kulkarni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... subthreshold activity was abolished with glutamate receptor antagonists 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo-[f]quinoxaline-7-sulfonamide (NBQX; 10 μM; Santa Cruz Biotechnology) and DL-2-Amino-5-phosphonopentanoic acid (APV ...
-
No products found
because this supplier's products are not listed.
Yi-Wei Huang, et al.,
bioRxiv - Cell Biology 2024
Quote:
COS-7 cells (∼ 3-5 x 104) were grown on 8-well chamber glass slides (BD Falcon 8 chamber tissue culture-treated glass slides ...
-
No products found
because this supplier's products are not listed.
Rashmi K. Shrestha, et al.,
bioRxiv - Biochemistry 2022
Quote:
... labeled protein was visualized using the AP substrate 5-bromo-4-chloro-indolyl-phosphate/nitro blue tetrazolium (BCIP/NBT; Southern Biotech).
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Jinyang Wang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
No products found
because this supplier's products are not listed.
Marinelle Rodrigues, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 gr 4-Chloro-DL-phenylalanine (Alfa Aesar, cat. A13323), 15 gr agar per 1 L of media) ...
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... coated coverslips and incubated with 25 µM 5-chloro-2’-deoxyuridine (CldU) (MP Biomedicals 0210547891) (for RPA2 detection ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Alexander M. Horspool, et al.,
bioRxiv - Microbiology 2021
Quote:
... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ...
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Vikash Chandra, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The differentiation was started following 24 h of seeding and proceeded through a 7-stage differentiation protocol (stages 1 – 4 in adherent culture, stage 5 in AggreWell (Stemcell Technologies, #34421), and stages 6 and 7 in suspension culture).
-
No products found
because this supplier's products are not listed.
Ryley Collard, et al.,
bioRxiv - Neuroscience 2022
Quote:
... CD-1 (5-7 weeks old, Charles River Laboratories, Kingston, NY, USA), and CF-1 (5-7 weeks old ...
-
No products found
because this supplier's products are not listed.
Dillon S. McDevitt, et al.,
bioRxiv - Neuroscience 2019
Quote:
... recording electrodes (2-5 MΩ; borosilicate glass capillaries (WPI #1B150F-4) pulled on a horizontal puller from Sutter Instruments (model P-97) ...
-
No products found
because this supplier's products are not listed.
Valencia L. Potter, et al.,
bioRxiv - Cell Biology 2020
Quote:
Eye cups from mice aged 4-8 months (Figures 2–5) or 10 days postnatal (Figures 6, 7, 9) were fixed for five minutes in 1% PFA (Electron Microscopy Science) diluted in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Svenja K. Tetzlaff, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or the AMPA-receptor blocker 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX, Hello Bio, 5 µM) (n = 4 cells each) ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Alexander S. Zhovmer, et al.,
bioRxiv - Biophysics 2023
Quote:
Equimolar mixture of 3-amino-2-fluorobenzotrifluoride (Combi-Blocks, Cat#QA-4188) and 2,6-dichloro-4-isocyanatopyridine (Toronto Research Chemicals, cat#159178-03-7) were stirred and heated in anhydrous Toluene at 85°C overnight ...