-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Sonja Giger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ...
-
No products found
because this supplier's products are not listed.
Omar A. Saldarriaga, et al.,
bioRxiv - Pathology 2019
Quote:
... 7-color manual IHC kit (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Elissa Tjahjono, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 7 mM sodium selenite (Alfa Aesar), 10 µM CCCP (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ryszard S. Gomolka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked with 7% normal donkey serum (Jackson Immunoresearch) in PBS with 0.03% Triton-X-100 ...
-
No products found
because this supplier's products are not listed.
Andreas Mund, et al.,
bioRxiv - Systems Biology 2021
Quote:
... #415190-9041-000) were treated with UV light for 1 h and coated with APES (3-aminopropyltriethoxysilane) using Vectabond reagent (Vector Laboratories, Burlingame, CA, USA, cat. #SP-1800-7) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Thomas J. Diprospero, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 7-hydroxycoumarin-d5-sulfate and 7-hydroxycoumarin-13C6-glucuronide were purchased from Toronto Research Chemicals. 4-hydroxymephenytoin-d3 was purchased from MuseChem ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Sven Hagemann, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
Cat# HY-W007853-10 mM * 1 mL,
10 mM * 1 mL, USD $61.0
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
D3 agonist
Sold for research purposes only.
Cat# 1012.0, SKU# 1012-10 mg,
10mg, US $66.00 / EA, EURO, €60 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Jimin Lee, et al.,
bioRxiv - Biochemistry 2023
Quote:
... alcyone ACE2 dimer with 7 mM CHAPSO (Anatrace) were applied and blotted twice as previously described88 ...
-
No products found
because this supplier's products are not listed.
Nicolas Broguiere, et al.,
bioRxiv - Bioengineering 2019
Quote:
7-diethylamino 4-methylcoumarin (DEAC, 2a) was purchased from TCI Deutschland GmbH.
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Paloma García Casas, et al.,
bioRxiv - Cell Biology 2023
Quote:
COS-7 cells were seeded on µ-Dish 35 mm (Ibidi), co-transfected 24 h later with plasmids encoding ER-Mit RspA-splitFAST and either ER-StayGold ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Samantha R. Weaver, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... PTH(7-34) (Bachem), or vehicle (0.1% BSA in PBS ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
No products found
because this supplier's products are not listed.
Xinquan Liu, Debadyuti Ghosh,
bioRxiv - Bioengineering 2019
Quote:
... and Cyanine 7 (Cy7, Lumiprobe) was conjugated to monomeric BSA according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
No products found
because this supplier's products are not listed.
Joseph Deering, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and pixel size of 7 nm on a Continuum S imaging filter (Gatan). EELS elemental maps for carbon ...
-
No products found
because this supplier's products are not listed.
Tal Iram, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using 7 cycles for chromatin shearing on a Bioruptor Pico sonicator (Diagenode, Cat. No. B01060001). Prior to sonication ...
-
No products found
because this supplier's products are not listed.
Rinaldo D. D’Souza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... into one of ten cortical areas and performing iontophoretic injections (3 µA, 7 s on/off cycle for 7 minutes; Midgard current source; Stoelting) of biotinylated dextran amine (BDA ...
-
No products found
because this supplier's products are not listed.
Shirsendu Ghosh, et al.,
bioRxiv - Biophysics 2020
Quote:
7) Glass bottom culture dish (MatTek, 35 mm petri dish ...
-
No products found
because this supplier's products are not listed.
Bogdan B. Grigorash, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Keratin 7 (Genetex #GTX110414; 1:250), Keratin 8 (DSHB Hybridoma Product TROMA-I ...
-
No products found
because this supplier's products are not listed.
Sofia A. Quinodoz, et al.,
bioRxiv - Genomics 2020
Quote:
AEBSF (Gold Biotechnology CAS#30827-99-7) is added to the Proteinase K (NEB Proteinase K #P8107S ...
-
No products found
because this supplier's products are not listed.
Hélène Scheer, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10 pmol of gene-specific primer (Supplementary Table 7) and 10 pmol of a TruSeq RNA PCR index (RPI, Supplementary Table 7) 10 nmol of dNTP ...
-
No products found
because this supplier's products are not listed.
Julia Martz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and placenta (n = 7; Enzo Life Sciences, Farmingdale, NY), maternal plasma cytokines (IL-6 and IL-17A ...
-
No products found
because this supplier's products are not listed.
Chikako Okubo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse monoclonal anti-p53 (DO-7) (1:200, Novus Biologicals), goat polyclonal anti-p53 (1:100 ...
-
No products found
because this supplier's products are not listed.
Alireza Saidi-Mehrabad, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 7) ZymoBIOMICS™ DNA Microprep kit (Zymo Research, California, USA) with modifications ...
-
No products found
because this supplier's products are not listed.
Tommaso Zeppillo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM 6-cyano-7-nitroquinoxaline-2,3-dione (NBQX, Hello Bio, Bristol, UK) and 2 μM (R)-3-(2-Carboxypiperazin-4-yl)-propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Ashwathi Rajeevan, Riya Keshri, Sachin Kotak,
bioRxiv - Cell Biology 2020
Quote:
Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
No products found
because this supplier's products are not listed.
Matvei Khoroshkin, et al.,
bioRxiv - Systems Biology 2023
Quote:
... and end labeled with 3’-Azido-3’-dUTP and IRDye® 800CW DBCO Infrared Dye (LI-COR) on beads ...
-
No products found
because this supplier's products are not listed.
Joshua M. Boyte, et al.,
bioRxiv - Plant Biology 2023
Quote:
... pairs of 7 d old seedlings were transferred to 96-well LUMITRAC™ 200 plates (Greiner) containing 250 µl ½ MS (0.8% agar ...