-
No products found
because this supplier's products are not listed.
Claire V. Mulholland, et al.,
bioRxiv - Microbiology 2023
Quote:
Mtb cultures were grown to early log phase and then diluted to OD600 0.3 in 10 ml 7H9/OADC/glycerol/tyloxapol and labelled with propionic acid [1-14C] sodium salt (7 μCi) (American Radiolabeled Chemicals, Inc.). Cultures were incubated with shaking at 37 °C for two days and then spun down ...
-
No products found
because this supplier's products are not listed.
Samuel G. Nonis, et al.,
bioRxiv - Biochemistry 2020
Quote:
... pH 7 from the ProPlex crystallisation screen (Molecular Dimensions). An additive screen was then performed using the sitting-drop vapour diffusion method with 30 μL of reservoir solution (125 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, Mitja N. P. Remus-Emsermann,
bioRxiv - Microbiology 2023
Quote:
... arabidopsis plants were grown in Magenta GA-7 tissue-culture boxes (Bioworld) containing sterile zeolite as an inert soil substitute ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
D. Wünkhaus, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ML-SA5 (Enamine Ltd., 2418670-70-7), Bafilomycin A (Sigma ...
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Nicole M Sodir, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat monoclonal anti-neutrophils (Clone 7/4, Cedarlane, CL8993AP), rat monoclonal F4/80 (clone Cl:A3-1 ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... on a heated stir plate (IKA C-MAG HS 7) set to 30°C and ~250 rpm ...
-
No products found
because this supplier's products are not listed.
Jichuan Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
An Annexin V-APC/7-AAD Apoptosis Kit (Abnova, #KA3808) was used for the apoptosis analysis as described previously [18] ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... A rabbit anti-GFP primary antibody was used to detect HA::GFP::RAB-7 and a rabbit anti-CD63/TSP-7 antibody (Abclonal, A5271, 1:500, RRID: AB_2766092) was used to detect CD63/TSP-7.
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Mason A. McCool, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Swollen cells were dounced using a 7 mL dounce (Wheaton, 3575420) for 20 strokes ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Ben Jin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... supplied with 7 ml of Dulbecco’s Modified Eagle’s Medium (Genesee, #25-500) containing 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Joshua A. Beitchman, et al.,
bioRxiv - Neuroscience 2020
Quote:
... All data were acquired on a 7 Tesla spectrometer (Oxford Instruments, Oxford, UK) controlled by a Bruker Biospec console (Bruker Biospin MRI Inc ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 3 µM CHIR99021(ReproCELL, Kanagawa, Japan), and 1% (v/v ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...
-
No products found
because this supplier's products are not listed.
K. M. Pruss, et al.,
bioRxiv - Microbiology 2020
Quote:
... Supernatant was filtered and dialyzed against dH2O with 1kD MWCO membranes (Spectra/Por 7, Spectrum Labs)) and subsequently lyophilized ...
-
No products found
because this supplier's products are not listed.
Gernot Neumayer, et al.,
bioRxiv - Bioengineering 2023
Quote:
Differentiated day 7 or enriched and expanded D50 iSCs were dissociated with Accutase (Innovative Cell Technologies) up to 30 minutes ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Samuel Vega Estevez, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were grown overnight and spheroplast were prepared in an agarose plug by treating cells (~ OD600=7) with 0.6 mg/ml Zymolyase 100T (Amsbio #120493-1) in 1% Low Melt agarose (Biorad® # 1613112) ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Rosalie Sinclair, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 50 μM endosiden 7(ES7) (ChemBridge) (or otherwise indicated concentration ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Pranay Shah, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 3 μM of CHIR99021 (Cambridge Bioscience, SM13-5) and 10 μM of Y-27632 ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Jiejie Geng, et al.,
bioRxiv - Immunology 2021
Quote:
Forty human cytokines were detected by Quantibody® array kits (QAH-INF-3, RayBiotech) according to the manufacturer’s protocol ...