-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
David M. Anderson, et al.,
bioRxiv - Microbiology 2023
Quote:
... N-(acid-PEG10)-N-bis(PEG10-azide) (2803119-06-2, Broadpharm), β-Lactose-PEG3-azide (246855-74-3 ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
3-Cyano-7-ethoxycoumarin is a small molecule which can act as a Cytochrom P450 Fluorescent...
Cat# abx282329-10MG,
10 mg USD $166.75
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
No products found
because this supplier's products are not listed.
David L. Goldblatt, et al.,
bioRxiv - Immunology 2019
Quote:
... and 2,3-bis(palmitoyloxy)-2-propyl-Cys-Ser-Lys-Lys-Lys-Lys-OH (Pam2CSK4) as the trifluoroacetic acid salt was purchased from Peptides International (Louisville, KY). A solution of ODN (1 µM ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Zengqi Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fatty acid free BSA (Equitech-Bio, USA) was dissolved in FBS-free DMEM at room temperature according the ratio 1:100 (1 g fatty-acid free BSA ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Ioannis Kanakis, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Samples were processed with Clip-Clap™ Acid Pyrophosphatase (Cambio, UK) prior to the library preparation to remove any 5’ cap structures ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Jana-Freja Frommann, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 0.1% (v:v) formic acid (∼98%, LC-MS grade, Honeywell Research Chemicals, Fluka) in H2OMilliQ (phase A ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Periodic Acid-Schiff (PAS) Diastase Stain Kit (for polysaccharides staining) (ScyTek Laboratories), and Amyloid Stain Kit (Congo Red ...
-
No products found
because this supplier's products are not listed.
Adam McNee, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated with 2 μg/ml rec 2-12C (Absolute Antibody) in PBS-T overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Antonius A de Waard, et al.,
bioRxiv - Immunology 2020
Quote:
... CD8+ T cell clones recognizing peptides derived from the endogenously expressed proteins USP11 and SSR1(7, 8) were expanded using a standard feeder mix in IMDM supplemented with 5% human serum (Sanquin) and 5% FCS(9).
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Gong-Her Wu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Quantifoi®l R 2/2 Micromachined Holey Carbon grid: 200 mesh gold (SPI supplies Cat#:4420G-XA) grids were prepared for cell plating by sterilizing using forceps to carefully submerge them in 100% ethanol (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... A SARS-CoV-2 neutralization antibody (EpiGentek), which targets the spike RBD ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Jinbao Liu, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Then the mixture was centrifuged at 200 g for 2 min and the supernatant was transferred to a new 2 mL Tube (CELLTREAT, catalog number: 229446) and centrifuged at 1,000 g for 5 min ...
-
Recombinant Antigen
Cat# REC31676-100,
100µg USD $837.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... SARS-CoV-2 S2 (The Native Antigen Company, REC31807-500), S1 (The Native Antigen Company ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...