-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Wenwen Tang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 14C-labeled arachidonic acid (2 μM, 14C-ARA, Moravek, MC364) or 14C-labeled oleic acid (1 μM ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Huntly M. Morrison, et al.,
bioRxiv - Immunology 2022
Quote:
Peptides were resuspended in 0.1% formic acid and 3% directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 3 μm ...
-
No products found
because this supplier's products are not listed.
Ignacio Babiloni-Chust, et al.,
bioRxiv - Physiology 2022
Quote:
... cells were incubated with Caspase-Glo® 3/7 reagent at room temperature before recording luminescence with a POLASTAR plate reader (BMG Labtech, Germany).
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Wenyi Zhang, Yang Xie, Tianming Yang,
bioRxiv - Neuroscience 2021
Quote:
... We recorded extracellular single-unit activities with tungsten microelectrodes (FHC: 0.3-2 MΩ; AlphaOmega: 0.5-3 MΩ). Each electrode was driven by an independent microdrive (AlphaOmega EPS ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... glycocholic acid (GCA) and taurocholic acid (TCA) were purchased from Steraloids (Newport, RI, USA). Cholic acid 7-sulfate (CA-S ...
-
No products found
because this supplier's products are not listed.
Samuel G. Nonis, et al.,
bioRxiv - Biochemistry 2020
Quote:
... pH 7 from the ProPlex crystallisation screen (Molecular Dimensions). An additive screen was then performed using the sitting-drop vapour diffusion method with 30 μL of reservoir solution (125 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 2: 2-Amino-6-(prop-2-ynoxycarbonylamino)hexanoic acid (LysAlk, AstaTech); 3 ...
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, et al.,
bioRxiv - Genetics 2021
Quote:
... 2% glucose] or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% glucose). All solid media contained 1.5% agar ...
-
No products found
because this supplier's products are not listed.
Sean G Rudd, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 10 mM ascorbic acid and 2 μM ATTO-488 azide fluorophore (ATTO-TEC), which was added to wells and incubated in the dark for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Dali Zong, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
No products found
because this supplier's products are not listed.
Jitendra S. Kanshana, et al.,
bioRxiv - Genetics 2021
Quote:
... non-esterified fatty acids or NEFAs (HR series NEFA-HR[2] Reagents; Wako Diagnostics), leptin (mouse leptin ELISA ...
-
No products found
because this supplier's products are not listed.
Simon Amiard, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and chromatin sonicated using the Diagenode Bioruptor (set to high intensity, 3 times 7 cyles (30sec ON / 30 sec OFF) or the S220 Focused-ultrasonicator (Covaris) for 20 min at peak power 110 W ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Ou Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 70 µL serum was applied to the human obesity array (RayBiotech, #QAH-ADI-3-2) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Manuela Fuchs, et al.,
bioRxiv - Microbiology 2020
Quote:
... the reactions were neutralized with Acetic acid and were purified with 2 volumes of MagSi-NGSPREP Plus beads (AMSBIO). A second 3Tr3 adaptor were ligated to the cDNA using T4 RNA Ligase (NEB ...
-
No products found
because this supplier's products are not listed.
Sonali Gupta, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The amino acid solutions consisted of either EZ Amino Acids (AA, Teknova) or a modified amino acid solution (AA* ...
-
No products found
because this supplier's products are not listed.
Yuzuki Shimamori, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were negatively stained with 2% phosphotungstic acid (w/v, pH 7.0) and observed using a JEM-1200EXII electron microscope (JEOL, Japan). Micrographs were taken at an accelerating voltage of 80 kV.
-
No products found
because this supplier's products are not listed.
Rachel E. Young, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The apparent pKa of LNPs was determined via TNS [6-(p-toluidinyl)naphthalene-2-sulfonic acid] (Thomas Scientific, Swedesboro, NJ) assays ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Tiziana Romanazzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Obeticholic acid (OCA) (Adipogen, Switzerland). LCA or OCA powder was dissolved in DMSO at 50 mM and 100 mM ...
-
No products found
because this supplier's products are not listed.
Daniel Ferguson, et al.,
bioRxiv - Physiology 2022
Quote:
... or amino acids (MyBioSource Cat# MBS6120661) with indicated treatments for 2 hours ...
-
No products found
because this supplier's products are not listed.
Casimir Bamberger, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2xStrep tagged SARS-CoV-2 ORFs were immunoprecipitated using 30 μl of Megastrep type 3 XT beads (IBA LifeSciences, Germany), and flag-tagged SARS-CoV-2 ORFs were immunoprecipitated using Anti-DYKDDDDK Magnetic Agarose (Pierce ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Mahmoud S Alghamri, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3′-diaminobenzidine (DAB) (Biocare Medical) with nickel sulfate precipitation ...
-
No products found
because this supplier's products are not listed.
Rita Gil, Mafalda Valente, Noam Shemesh,
bioRxiv - Neuroscience 2023
Quote:
... The acid was injected using a Nanojet II (Drummond Scientific Company). Animals were anesthetized with isoflurane (anesthesia induced at 5% concentration and maintenance below 3%) ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Thomas J. Kucharski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Okadaic acid (LC Labs O-5857) was used at 200 nM ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...