-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Simonas Juzenas, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The 3’-amino modified oligos (Supplementary Table S5) were activated by 1 mM NHS-methyltetrazine (Click Chemistry Tools) in 50% DMSO for 60 min at 21 °C ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Jonathan Tai, et al.,
bioRxiv - Biochemistry 2023
Quote:
... [1-14C]-IPP and [phenyl-14C]-4-HB were purchased from American Radiolabeled Chemicals. At each time point ...
-
No products found
because this supplier's products are not listed.
Kerry M. Goodman, et al.,
bioRxiv - Biophysics 2021
Quote:
... 10% Morpheus Amino Acids (Molecular Dimensions), and 0.1 M Morpheus Buffer System 2 (Hepes/MOPS buffer ...
-
No products found
because this supplier's products are not listed.
Daniel Ferguson, et al.,
bioRxiv - Physiology 2022
Quote:
... or amino acids (MyBioSource Cat# MBS6120661) with indicated treatments for 2 hours ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Joseph Y Ong, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 6.7 g Difco(tm) Yeast Nitrogen Base without Amino Acids (Bioworld), 2.0 g Drop-Out Mix Synthetic Minus Arginine without Yeast Nitrogen Base (US Biological) ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Zoe L. Watson, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and 0.5 mM 2’-NH2-ATP (2’-amino-2’-deoxyadenosine-5’-triphosphate, purchased from Axxora). Reactions were incubated at 37 °C for 2 h ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... Imaging strands with a 3’amino group were reacted using succinimidyl ester chemistry with NHS-ATTO 643 (ATTO-TEC, AD 643-31). All reactions were performed at at room temperature in ultrapure water adjusted to pH~8.5 using 1 M sodium bicarbonate (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Simon Amiard, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and chromatin sonicated using the Diagenode Bioruptor (set to high intensity, 3 times 7 cyles (30sec ON / 30 sec OFF) or the S220 Focused-ultrasonicator (Covaris) for 20 min at peak power 110 W ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
RBD of 223 amino acid (Arg319-Phe541) fragment of the SARS-CoV-2 Spike protein that binds to the ACE2 receptor (Raybiotech, 230-30162-100) was biotinylated using NHS-PEG4-Biotin (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Megan R. Sayyad, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and non-essential amino acids (0.02mM, Gemini Bio-Products). The mouse mammary carcinoma cell line 4T1 (gift from Dr ...
-
No products found
because this supplier's products are not listed.
Cori K. Cahoon, et al.,
bioRxiv - Developmental Biology 2022
Quote:
The quantification of GFP::SYP-2 and mCherry::SYP-3 was performed using Imaris (Oxford Instruments) in combination with our whole gonad analysis ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Yukitoshi Izumi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Finasteride (CAS#:98319-26-7) was from Steraloids (Newport RI).
-
No products found
because this supplier's products are not listed.
Casimir Bamberger, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2xStrep tagged SARS-CoV-2 ORFs were immunoprecipitated using 30 μl of Megastrep type 3 XT beads (IBA LifeSciences, Germany), and flag-tagged SARS-CoV-2 ORFs were immunoprecipitated using Anti-DYKDDDDK Magnetic Agarose (Pierce ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Mason A. McCool, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Swollen cells were dounced using a 7 mL dounce (Wheaton, 3575420) for 20 strokes ...
-
No products found
because this supplier's products are not listed.
Matthew Herdman, et al.,
bioRxiv - Microbiology 2023
Quote:
... cells were supplemented with 500 µM of the fluorescent D-amino acid HADA93 (Cambridge Biosciences) for the last 10 minutes of the chase-labelling incubation ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Mahmoud S Alghamri, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3′-diaminobenzidine (DAB) (Biocare Medical) with nickel sulfate precipitation ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...
-
No products found
because this supplier's products are not listed.
Miguel Á. Muñoz-Alía, et al.,
bioRxiv - Microbiology 2022
Quote:
Heavy and light chain amino acid sequences were downloaded from the CoV-AbDab database and synthesized as codon-optimized gBlock fragments (GENEWIZ). These antibodies were expressed using the Expi293 expression system kit (Cat# A14635 ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Samuel Vega Estevez, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were grown overnight and spheroplast were prepared in an agarose plug by treating cells (~ OD600=7) with 0.6 mg/ml Zymolyase 100T (Amsbio #120493-1) in 1% Low Melt agarose (Biorad® # 1613112) ...