1 - 50 of 606
suppliers found for
7 Amino 3 phenyl 2 benzopyrone
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 4108-61-6, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 5,7-Dihydroxy-2-(4-hydroxyphenyl)-4-benzopyrone] were procured from Sigma (Steinheim, Germany). Emetine was dissolved in phosphate buffered saline (PBS ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in Exocytosis of the silicified cell wall of diatoms involves extensive membrane disintegrationbioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cerebral Cortex doi: 10.1093/cercor/bhz081Quote: ... N-[2-[[(Hexahydro-2-oxo-1H-azepin-3-yl)amino]carbonyl]phenyl]benzo[b]thiophene-2-carboxamide (ANA12, 10 µM) (Tocris), (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in Human neutrophils are not activated by Zika virus but reduce the infection of susceptible cellsbioRxiv - Immunology 2021Quote: ... and 7-Amino-Actinomycin (7-AAD; BD Bioscience) following manufacturer’s instructions (PE Annexin V Apoptosis Detection Kit ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2017, published in Nature Communications doi: 10.1038/s41467-018-04821-5Quote: ... and 1-palmitoyl-2-{6-[(7-nitro-2-1,3-benzoxadiazol-4-yl) amino] hexanoyl}-sn-glycero-3-phosphocholine (NBD-PC; Avanti Polar Lipids) were dissolved in chloroform and mixed in a w/w ratio of 200:1 (PC:NBD-PC) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Multiplexed biochemical imaging reveals caspase activation patterns underlying single cell fatebioRxiv - Cancer Biology 2018Quote: ... 7-AAD (7-amino-actinomycin D; Biolegend; 1:200), CaCl2 (2.5 mM ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1915520117Quote: ... 7-Amino-actinomycin D (Calbiochem) was added (Fig ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... The fluorescent glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) was purchased from Cayman Chemical Company ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Oligomerization processes limit photoactivation and recovery of the Orange Carotenoid ProteinbioRxiv - Biophysics 2022Quote: ... hydrophobic chromatography on a phenyl-sepharose column (HiTrap Phenyl HP, GE Healthcare) and size exclusion chromatography on an analytical HiLoad 16/60 Superdex 75 (HiLoad 16/600 Superdex 75 pg ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... cells were cultivated four days in the presence of 2.5 μM D-threo-l-phenyl-2-palmitoylarmino-3-morpholino-l-propanol (PPMP; Santa Cruz) to inhibit synthesis of glucosylceramide-based GSLs [41]. -
Hello Bio
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ... -
Worthington Biochemical
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...Cat# LS005333, 500 mg, $229.0 AskbioRxiv - Immunology 2018, published in The Journal of Immunology doi: 10.4049/jimmunol.1800586Quote: ... 3 µg/ml L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical, Lakewood NJ) and 25 mM HEPES (Quality Biological) ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in ER shaping proteins regulate mitochondrial fission, outer membrane permeabilization and apoptosisbioRxiv - Cell Biology 2018Quote: ... caspase-3 and caspase-7 from Cell Signaling Technologies (Danvers, MA, USA) and GAPDH from SantaCruz Biotechnologies (Santa Cruz ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB). -
Addgene
No products found because this supplier's products are not listed.Cited in Intermitochondrial signaling regulates the uniform distribution of stationary mitochondria in axonsbioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018, published in Antimicrobial Agents and Chemotherapy doi: 10.1128/aac.02410-18Quote: ... while 2-phenyl-1,2-benzisoselenazol-3(2H)-one (ebselen, Eb, PubChem SID 856002) and glucosamine hydrochloride were obtained from VWR International (West Chester ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in DNAJB1-PRKACA in HEK293T cells induces LINC00473 overexpression that depends on PKA signalingbioRxiv - Cancer Biology 2021Quote: Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... non-essential amino acids 2 % (Lonza, Bäle, Switzerland), FGF 1 ng/mL (PeproTech ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2020, published in Frontiers in Plant Science doi: 10.3389/fpls.2021.613568Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Epidemiology 2020, published in Pathogens doi: 10.3390/pathogens9030176Quote: ... then ticks were washed by gentle shaking over 2-3 min at 7 Hz/s in a Tissue Lyzer (Qiagen, Germany). After discarding the supernatant ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... IL-2 and IL-7 were purchased from Peprotech, reconstituted in sterile water ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Frontiers in Microbiology doi: 10.3389/fmicb.2018.00193Quote: To test whether the NO-scavenger 2-phenyl-4,4,5,5,-tetramethylimidazoline-3-oxide-1-oxyl (PTIO; TCI, Germany) inhibits ammonia oxidation by Ca ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ... -
Phenomenex
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Diabetes doi: 10.2337/db20-0384Quote: ... Glycolytic and TCA intermediates were separated on a Luna Amino (NH2) column (3 µm, 100A 2 × 150 mm, Phenomenex), that was maintained in a temperature-controlled chamber (37°C). -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in eLife doi: 10.7554/elife.37243Quote: ... or 3-azido-7-hydroxycoumarin (Jena Biosciences, Jena, Germany). For M ... -
Bachem
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2021Quote: ... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Polybead Amino Microsphere 3 μm latex beads (Polysciences INC) were labeled with the fluorescent dye DyLight680 mono-N-hydroxysuccinimide (NHS ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2019, published in Annals of Botany doi: 10.1093/aob/mcz023Quote: ... C613-phenyl-IAA (50 pmol, Cambridge Isotope Laboratories Inc. ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: Gly-Phe-7-Amino-4-Trifluoromethylcoumarin (GF-AFC, MP biomedicals, SKU 03AFC03325) substrate was diluted in PBS and 1.0 μL/well was added with a Multidrop Combi Reagent Dispenser (Thermo Fisher ... -
Anaspec
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... and oligosaccharides were labeled with 7-amino-1,3-naphthalenedisulfonic acid (81529, AnaSpec) prior to electrophoresis on 20% acrylamide gels ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Scientific Reports doi: 10.1038/s41598-020-62089-6Quote: ... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nature Communications doi: 10.1038/s41467-019-13810-1Quote: ... 0.7 µM of total delta-Phe aa-tRNA (total tRNA charged with all amino-acids except Phe; tRNA from Roche) and 100 nM of EF-G were used ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017Quote: ... Glucose uptake was measured by incubating embryos in 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NDBG, Lifetechnologies) followed by imaging on a confocal macroscope (Leica). -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: Plasmids encompassing the non-canonical amino acid residue p-benzoyl-L-phenyl alanine (Bpa, Alfa Aesar #52083) were generated by inserting a TAG stop codon at the desired crosslinking position in the appropriate plasmid (construction detailed above) ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 Green Reagent (2.5 µM / well, Sartorius), Z-VAD-FMK (50 µM / well ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ... -
PerkinElmer
No products found because this supplier's products are not listed.Cited in Stem cell delivery to kidney via minimally invasive ultrasound-guided renal artery injection in micebioRxiv - Cell Biology 2019Quote: ... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... of fluorescent hydrolysate of Boc-Gln-Ala-Arg-MCA (7-amino-4-methylcoumarin) were read using SpectraMax M5 plate reader (Molecular Devices, San Jose, CA, USA) with excitation of 380 nm and emission of 460 nm ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... or 7-Amino-Actinomycin D (7-AAD, Beckman Coulter, B88526) was added to the cell suspensions ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ... -
IRIS Biotech
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...