-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Hiroyuki Kawano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... in two stages and using a vertical pipette puller (PB-7, Narishige International USA). The resistance of the recording electrode was 5-7 MΩ ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Emiko Kranz, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured in IMDM supplemented with 7% ultra-low IgG FBS (FB-06, Omega Scientific), Antibiotic-Antimycotic ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Michael B. Geary, et al.,
bioRxiv - Pathology 2022
Quote:
... and the skin was closed with either 7 mm stainless steel wound clips (CellPoint Scientific Inc., Gaithersburg, MD) or a series of interrupted 5-0 nylon sutures ...
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Shanti Pal Gangwar, et al.,
bioRxiv - Biophysics 2019
Quote:
Crystallization screening was performed with GLR3.2-S1S2 protein at a concentration of ~7 mg/ml using Mosquito robot (TTP Labtech) and sitting drop vapor diffusion in 96-well crystallization plates ...
-
No products found
because this supplier's products are not listed.
Fabian Stefan Franz Hartmann, et al.,
bioRxiv - Microbiology 2021
Quote:
... Spotting was conducted by setting an overshoot of 1.5 mm and a pin-pressure of 7 % using long 96-well pins (Singer Instruments). To avoid reflection from the plastic edges of the OmnyTray plates as well as effects resulting from the outer barrier of arrayed colonies ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Antonius A de Waard, et al.,
bioRxiv - Immunology 2020
Quote:
... CD8+ T cell clones recognizing peptides derived from the endogenously expressed proteins USP11 and SSR1(7, 8) were expanded using a standard feeder mix in IMDM supplemented with 5% human serum (Sanquin) and 5% FCS(9).
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Yi Ran, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... cell extracts (3 ml of the supernatant) were incubated with Anti-Flag Affinity Gel (Bimake) at 4 °C for 3 h ...
-
No products found
because this supplier's products are not listed.
Wei Ge, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... the slides were then blocked with 3 % BSA and 10 % donkey serum (Boster, Wuhan, China) in 0.5 M Tris-HCI buffer for 30 min ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (4-(1,2,4,5-tetrzain-3-yl)phenyl)methanamine (tetrazine amine) was purchased from Kerafast (FCC659, lot: 2014). 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...