-
No products found
because this supplier's products are not listed.
Gouranga Saha, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
No products found
because this supplier's products are not listed.
Vanessa B. Sanchez, Saima Ali, Math P. Cuajungco,
bioRxiv - Cell Biology 2019
Quote:
... the cells were incubated with 1 μM cell membrane permeable Fluozin-3 acetoxy-methyl ester (AM) fluorescent dye (MP-FZ3; Kd =15 nM; ex = 494 nm, em = 516 nm; Thermo Scientific). Fluozin-3 is a well-established tool for evaluating changes in relative zinc levels due to its specificity ...
-
No products found
because this supplier's products are not listed.
MG Booty, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Caspase 3/7 indicator dye (Sartorius, Germany) and propidium iodide (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Isaac González-Santoyo, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3-Hk (Sigma-Andrich; Catalogue number: 2147-61-7) was dissolved in distilled water using a vortex mixer for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Mégane Brusson, et al.,
bioRxiv - Genetics 2022
Quote:
... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
No products found
because this supplier's products are not listed.
Jiapeng Liu, Christie Dapper, Michael Klemba,
bioRxiv - Microbiology 2023
Quote:
... 3- azido-7-hydroxycoumarin was acquired from Abcam. Piperazine-based MAGL inhibitors described in Aaltonen et al20 were provided by Dr ...
-
No products found
because this supplier's products are not listed.
Jose A. Valverde-Lopez, et al.,
bioRxiv - Developmental Biology 2023
Quote:
FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Gerarda H. Khan, et al.,
bioRxiv - Immunology 2023
Quote:
... 7-aminoactinomycin-D (7-AAD; BioLegend), FAS-PEcy7 (DX2 ...
-
No products found
because this supplier's products are not listed.
Justin A. Peruzzi, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(Cyanine 7) (Cy 7 PE) were purchased from Avanti Polar Lipids. 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Zhikai Zeng, et al.,
bioRxiv - Biophysics 2023
Quote:
Protein was spin-labeled using MTSL ((1-Acetoxy-2,2,5,5-tetramethyl-δ-3-pyrroline-3-methyl) Methanethiosulfonate) purchased from Toronto Research Chemicals. Prior to labeling ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Paula Tucci, et al.,
bioRxiv - Microbiology 2019
Quote:
... Proteins were loaded into 7 cm IPG Strips 3-10 (GE Healthcare) by overnight passive rehydration ...
-
No products found
because this supplier's products are not listed.
Imke L. Lemmer, et al.,
bioRxiv - Physiology 2023
Quote:
... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Anna C. Dragon, et al.,
bioRxiv - Immunology 2023
Quote:
... with 3% human serum (c.c.pro; CTL medium) supplemented with 12.5 ng/ml IL-7 and IL-15 (PeproTech). On day 1 ...
-
No products found
because this supplier's products are not listed.
Christopher Jonkergouw, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-(3-Hydroxy-7-cis-tetradecanoyl)-L-HSL (>95%) (3-OH-C14:1) was used as received from Cayman Chemical. Organic solvents were purchased from Sigma-Aldrich and VWR ...
-
No products found
because this supplier's products are not listed.
Moritz Hunkeler, Cyrus Y. Jin, Eric S. Fischer,
bioRxiv - Molecular Biology 2022
Quote:
pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
No products found
because this supplier's products are not listed.
May Zaw Thin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ...
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-cyano-7-ethoxycoumarin (CEC, 30 μM; Cyp1a2; Cat. No. 451014. Corning Inc.), coumarin (CM ...
-
No products found
because this supplier's products are not listed.
Robert Schönherr, et al.,
bioRxiv - Biophysics 2023
Quote:
... at 40 °C and for 7 min in 3 % lead citrate (Ultrostain II, Leica) at 20 °C ...
-
No products found
because this supplier's products are not listed.
Tiantian Wu, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Coilin (Santa Cruz, F-7); Fibrillarin (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Constanza Salinas-Rebolledo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Joseph W. Salatino, Arya P. Kale, Erin K. Purcell,
bioRxiv - Bioengineering 2019
Quote:
... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
David J. Thaller, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
No products found
because this supplier's products are not listed.
Erna Raja, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 0.03 to 3 μg/well of the soluble mouse or human HA-tagged recombinant fibulin 7 (R&D Systems) in 2% dry milk/TBS and 2 mM CaCl2 were added to the wells and incubated for 3 hours ...
-
No products found
because this supplier's products are not listed.
The International Brain Laboratory, et al.,
bioRxiv - Neuroscience 2020
Quote:
Animals (all female and male C57BL6/J mice aged 3-7 months obtained from Jackson Laboratory or Charles River) were co-housed whenever possible ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Jan Zlamal, et al.,
bioRxiv - Immunology 2022
Quote:
Immunofluorescence images were aquired from 3-5 randomly chosen microscopic fields in different fluorescence channels (x40 magnification) using a Zeiss Axio Observer 7 (Carl Zeiss, Oberkochen, Germany). Images were processed identically using adjusted threshold settings and exclusion of image artefacts by using Fiji image processing software.33 Thrombus formation was determined by measuring the surface area coverage (SAC ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Jessica M Snyder, et al.,
bioRxiv - Pathology 2020
Quote:
... 7 Cyp26b1−/− (3M, 4F), and 6 Cyp26b1+/− (3M ...
-
No products found
because this supplier's products are not listed.
Taiki Satoh, et al.,
bioRxiv - Immunology 2021
Quote:
... 10 ng/ml IL-7 (Miltenyi Biotec), 2 mM L-Glutamine ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Hailey Axemaker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The spheroids were grown for 21 days and imaged every 7 days with Cytation 3 Imaging reader (Biotek, Winooski, VT, USA). ImageJ software was used to measure the lengths and areas of the spheroids to compare the formed spheroids over time ...
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7) DC3000 − A (Illumina only), 8 ...
-
No products found
because this supplier's products are not listed.
Hongchen Shen, et al.,
bioRxiv - Microbiology 2021
Quote:
... and a dye photosensitizer in N,N-dimethylformamide/acetone (7/3, v/v) was electrospun onto one layer of polypropylene (PP) fabrics (VWR® Basic Protection Face Mask). During the electrospinning of 10-20 wt% of PVDF ...
-
No products found
because this supplier's products are not listed.
Zahraa Alraies, et al.,
bioRxiv - Cell Biology 2023
Quote:
Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
No products found
because this supplier's products are not listed.
Mathilde Ambrosino, et al.,
bioRxiv - Bioengineering 2023
Quote:
The size and shape of the microgels were observed under light microscopy over time (immediately after microencapsulation, then 1, 3, 7, and 14 days) using confocal microscopy Nikon A1RSi (Nikon Champigny sur Marne). The microgels were immersed in complete cell culture medium and stored at 37°C ...
-
No products found
because this supplier's products are not listed.
Zhihang Yuan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...