-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Katelyn A. Bustin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (Bullet Blender, BBY24M model, Next Advance, Inc., speed 8, 3 min, 4 °C), samples were diluted in PBS (500 μL ...
-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
Cat# 951163-60-3,
Inquire
Ask
Ana C. Puhl, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (12) was purchased from BOC Sciences (Shirley NY). The purity of this compound was greater than 95% ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and arachidonic acid (20:4) (Nu-Chek Prep, Inc., Elysian, MN), each at a final concentration of 100 µM ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Megan R. Sayyad, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and non-essential amino acids (0.02mM, Gemini Bio-Products). The mouse mammary carcinoma cell line 4T1 (gift from Dr ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Eric Hee Jun Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Tumor tissue was fixed for up to 3 days in 4% paraformaldehyde (4% PFA, Boston BioProducts) and stored in 70% ethanol until further processing ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Dali Zong, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Kai Otsuka, et al.,
bioRxiv - Genomics 2023
Quote:
... containing 2i (1 μM PD0325901, LC Laboratories, MA; and 3 μM CHIR99021, LC Laboratories) and LIF (1,300 U /ml ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Cierra N. Sing, et al.,
bioRxiv - Cell Biology 2021
Quote:
... BCAA levels were determined using the Branched Chain Amino Acid Assay kit (Cell Biolabs Inc., San Diego CA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Filippo Macchi, Eric Edsinger, Kirsten C. Sadler,
bioRxiv - Genomics 2022
Quote:
... or anti-5-methyl-cytosine (5mC – Aviva Biosystem clone 33D3 ...
-
No products found
because this supplier's products are not listed.
Allison A. Fitzgerald, et al.,
bioRxiv - Immunology 2023
Quote:
... were maintained on plastic and passaged every 1-3 days in stellate cell medium (ScienCell, cat#5301). For all experiments ...
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... IN) or choline deficient amino acid defined diet containing 10% fat by calories (CD-LFD) (A06071302i, Research diets, New Brunswick, NJ) were used as controls ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Laminar-flow-separated channels 1-3 were used to form DNA tethers between two 4.35-μm streptavidin-coated polystyrene beads (Spherotech). Channels 4 and 5 served as protein loading and imaging channels ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... recombinant IL-4 and IL-5 (10 ng/mL; Tonbo Bioscience) cytokines ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... amino acids (5 eq) were activated with N,N′-diisopropylcarbodiimide (DIC, 5 eq, Oakwood Chemical)/Oxyma (5 eq ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Francisco del Caño-Ochoa, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 ml of heat-inactivated FBS were dialyzed against 1 L of tap water for 1 day at 4°C using SpectraPor #3 dialysis tubing with a molecular weight cutoff of 3,500 Da (Spectrum Laboratories, Inc., USA), supplemented with NaCl (9 g per liter) ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Yu-Cheng Chen, et al.,
bioRxiv - Bioengineering 2019
Quote:
... were coated with 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000] (DSPE-PEG, Nanocs) in order to reach a stable nanoparticle dispersion in aqueous solution ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Antoniel Gomes, et al.,
bioRxiv - Biophysics 2024
Quote:
... Labeling with the Tb-cryptate for the LRET experiments was carried out by incubating the β-arrestin 1 with 2 equivalents of Lumi-4 Tb maleimide (CisBio) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Leon Zhen Wei Tan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Wild-type PAO1 were fed with ABTG containing either freshly prepared 2 µM auranofin or DMSO (as solvent control) at the rate of 4 ml h-1 via peristaltic pump (Cole-Parmer®) in 37 °C condition ...