-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Coralie Zangarelli, et al.,
bioRxiv - Genomics 2022
Quote:
A peptide corresponding to PgmL1 amino acid sequence 1 to 266 and carrying a C-terminal His tag was used for guinea pig immunization (Proteogenix). Sera were purified by antigen affinity purification to obtain highly specific α−PgmL1-GP antibodies (0.8 mg/mL) ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Ludovic Spaeth, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4% for induction then 1-2% for the surgery) and mounted on a stereotaxic frame (Model 68526, RWD Life Science). Body temperature was monitored using a rectal probe and maintained with a heat pad ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Overnight primary antibody incubation at 4°C was completed for the following targets: PDE11A (Aves custom PDE11#1 at 1:10,000; Fabgennix PD11A-112 at 1:500), CREB (Cell Signaling #4820 at 1:10,000 ...
-
No products found
because this supplier's products are not listed.
David P. Cook, Barbara C. Vanderhyden,
bioRxiv - Cell Biology 2020
Quote:
... PCR products were then run on a 1% agarose gel containing RedSafe Nucleic Acid Staining Solution (Intron Biotechnology) and visualized with an EpiChem II Darkroom Transilluminator (UVP Laboratory).
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Jitendra S. Kanshana, et al.,
bioRxiv - Genetics 2021
Quote:
... non-esterified fatty acids or NEFAs (HR series NEFA-HR[2] Reagents; Wako Diagnostics), leptin (mouse leptin ELISA ...
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Riccardo Baroncelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... 200 mg of mycelium were placed into a 2 mL sterile extraction tube prefilled with 0.35 g of acid washed silica glass beads (0.5 mm) (Benchmark Scientific Inc., NJ). 50 mg of PVP40 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Ahmed S Abdelfattah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ~1×105 cells per well in 100 μL of a 4:1 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Apirat Chaikuad, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the 5 uL reaction was performed with 4 ug/mL recombinant human ULK2 protein (1-478, SignalChem #U02-11G) and 80 ug/mL MBP in the presence of 25 uM ATP ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
magnetofection
difficult to transfect cells
Cat# KC30296,
PolyMag 100µL+PolyMag Neo100µL+ CombiMag 100µL+Magnetic Plate MF96000, USD $640.63/KIT
Ask
Evangelos D. Karousis, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 20 ng/µl pSUPuro plasmid (1:1 mixture of pSUPuro UPF1 against two target sequences 52) in Opti-MEM containing 3% (v/v) Dogtor (OZ Biosciences) transfection reagent ...
-
No products found
because this supplier's products are not listed.
Kazuya Ishikawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... The membrane was treated with 1:1000 anti- lipoteichoic acid antibody (clone 55, Hycult Biotech, Uden, The Netherlands) and washed 3 times with phosphate buffered saline ...
-
No products found
because this supplier's products are not listed.
Rogan A. Grant, et al.,
bioRxiv - Immunology 2023
Quote:
... Remaining cells were then pelleted at 400g for 5 minutes at 4°C and resuspended at 1×106 cells/mL in ice-cold BamBanker medium (Bulldog Bio BB02). Cell suspensions were aliquoted at 2.5-5.0×105 cells and frozen directly at −80°C until sorting.
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Samantha Mar, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The spheroids were transferred into 500 μL acid ethanol (1 M HCl in 70% ethanol) for either human C-peptide ELISA (Alpco) or human glucagon ELISA (Mercodia).
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adult mice were immunized by intradermal injection of 100 µg of bovine type II collagen that was emulsified in 100 µl of emulsion containing 50 µl acetic acid (0.01 M) and 50 µl CFA (1 mg/ml Myobacterium tuberculosis; Chondrex Inc, Woodinville, WA) at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Akila Wijerathna-Yapa, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The samples were acidified to 1% (v/v) with formic acid and solid-phase extraction cleaned using Silica C18 Macrospin columns (The Nest Group). After each of the following steps ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Jacqueline F. Rivera, et al.,
bioRxiv - Neuroscience 2023
Quote:
The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
Cat# G209,
USD $10.00/EA
Ask
Taylor Anthony Stevens, et al.,
bioRxiv - Biochemistry 2023
Quote:
dPEG24-biotin acid (Quanta Biodesign, USA; cat. no. 10773)
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Kento T. Abe, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were washed three times with 200 μl PBS-T and blocked for 1-1.5 hr at room temperature with 200 μl 3% BSA (BioShop Canada Inc. #SKI400.1, lot #9H61850). After washing as above ...
-
No products found
because this supplier's products are not listed.
Wisath Sae-Lee, et al.,
bioRxiv - Systems Biology 2021
Quote:
... For ghosts dissolved in Diisobutylene/Maleic Acid (DIBMA, Cube Biotech) (Oluwole et al. ...
-
No products found
because this supplier's products are not listed.
Lazar Novaković, et al.,
bioRxiv - Plant Biology 2022
Quote:
dek1-4 pCESA3:GFP:CESA3 plants were transferred to MS 1% sucrose media supplemented with Plant Preservative Mixture (Plant Cell Technology, Washington DC, USA) diluted in ratio 1:1000 after CESA imaging ...
-
No products found
because this supplier's products are not listed.
Tino Pleiner, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 8% CO2 and 125 rpm shaking in 1 L roller bottles with vented caps (Celltreat, USA). For a small-scale prep ...
-
No products found
because this supplier's products are not listed.
Kate M. MacDonald, et al.,
bioRxiv - Cell Biology 2022
Quote:
MCF10A cells were cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Wisent Bioproducts cat #098150), 20 ng/ml human EGF (Cedarlane Labs cat #AF-100-15) ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Scott P. Souza, et al.,
bioRxiv - Immunology 2021
Quote:
... and blocked with coating buffer containing with 1% BSA (w/v) and 2% goat serum (Omega Scientific) in PBS ...