-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Silvia J. Park, et al.,
bioRxiv - Neuroscience 2023
Quote:
... eyecups were rinsed twice in PBS and embedded in 7% low-melt agarose (Precisionary, SKU VF-AGT-VM). The agarose-embedded eyecups were Vibratome-sectioned into 100 µm-thick slices (VT1200 ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and fractions 7 through 23 were collected using an automated fraction collector (Izon Science Ltd, 500 µL per fraction). A high sensitivity BCA assay (Pierce ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Mahmoud M. Elguindy, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Chromosome enumeration probes for chromosome 7 (CHR7-10-GR) and chromosome 20 (CHR20-10-RE) were purchased from Empire Genomics. Cells were trypsinized ...
-
No products found
because this supplier's products are not listed.
Vanessa Krauspe, et al.,
bioRxiv - Microbiology 2020
Quote:
... Gels were stained using either 20 mM zinc sulfate-7-hydrate for reversible zinc staining of chromophores and/or InstantBlue(tm) Coomassie staining (Expedeon). Otherwise ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Bryce A. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Litter-to-litter variation was controlled for by balancing treatment groups across litters. Nicotinamide riboside (CAS No. 1341-23-7) was obtained from ChromaDex (Los Angeles, CA) through participation in their External Research Program ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Nathan Jariwala, et al.,
bioRxiv - Cell Biology 2023
Quote:
... hyaluronic acid (Corgenix 029-001) and decorin (R&D Systems DY143 ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For experiments with endogenous FXR agonists: Chenodeoxycholic Acid (endogenous bile acid, FXR agonist, LKT Labs) and Obeticholic Acid (cholic acid derivative ...
-
No products found
because this supplier's products are not listed.
Iuliia Polina, et al.,
bioRxiv - Cell Biology 2023
Quote:
... valproic acid (AmBeed, Arlington Heights, IL); (trifluoromethoxy)phenylhydrazone (FCCP ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Anna Zagórska, et al.,
bioRxiv - Physiology 2020
Quote:
... in saturated aqueous solution of Picric Acid (LabChem)) ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... with 14.16□g of HEPES acid (STREM Chemicals) and 16.65 g of HEPES sodium salt (STREM Chemicals) ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Zhimin Zhou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 2.5 g fatty acid-free BSA (Proliant Biologicals).
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Gabriela Zurawska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mice received i.v.solution of liposomes containing clodronic acid (LIPOSOMA, #C-SUV-005) (5 ml/kg ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Periodic Acid-Schiff (PAS) Diastase Stain Kit (for polysaccharides staining) (ScyTek Laboratories), and Amyloid Stain Kit (Congo Red ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Andrew V. Grassetti, Rufus Hards, Scott A. Gerber,
bioRxiv - Cell Biology 2021
Quote:
... lyophilized peptides were dissolved in 50% acetonitrile (ACN; Honeywell) / 2M lactic acid (Lee Biosolutions), incubated with 1.25 mg TiO2 microspheres (GL Sciences ...
-
No products found
because this supplier's products are not listed.
Angel K. Kongsomboonvech, et al.,
bioRxiv - Immunology 2020
Quote:
... Stable integrants were selected in media with 50 μg/ml of mycophenolic acid (Axxora) and 50 μg/ml of xanthine (Alfa Aesar ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Jie Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 1% w/v deoxycholic acid (sodium salt)) supplemented with protease inhibitors (Bimake, Cat# B14001) followed by sonication ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Aruna Pal, Abantika Pal, Pradyumna Baviskar,
bioRxiv - Genomics 2020
Quote:
Nucleotide variation for the proteins was detected from their nucleotide sequencing and amino acid variations were estimated (DNASTAR). 3D structure of the derived protein was estimated for both indigenous ducks and chicken by Pymol software ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a booster injection with 100 µl of an emulsion of bovine collagen II (100 µg, 50 µl in 0.01 M acetic acid) and Incomplete Freund’s Adjuvant (IFA, 50 µl; Chondrex Inc, Woodinville, WA) was administered intradermally at a different location of the mouse tail ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Wei Ge, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... the slides were then blocked with 3 % BSA and 10 % donkey serum (Boster, Wuhan, China) in 0.5 M Tris-HCI buffer for 30 min ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Adriaan van der Graaf, et al.,
bioRxiv - Genetics 2020
Quote:
... Cells were left unstimulated (controls) or treated for 3 hours with IFNβ (300 ng/ml, Pbl Assay science, cat 11410-2), IL-15 (20 ng/ml ...