-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Maxence Le Vasseur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Gel slices (2mm x 7mm) were excised along the entire lane using disposable gel cutter grids (The Gel Company, San Francisco, CA, cat# MEE2-7-25). Ten gel slices ranging from ∼600-900kDa were collected in 100µl of 50mM ammonium bicarbonate (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Natasha M. O’Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
Larvae (7 dpf) were anesthetized with tricaine and injected with 2.3 nl of 5 nm NHS-activated gold nanoparticles (Cytodiagnostics: CGN5K-5-1, ~1.114 particles/ml in PBS) just as for the fluorescent tracer injections ...
-
No products found
because this supplier's products are not listed.
Jason A. Rothman, et al.,
bioRxiv - Systems Biology 2024
Quote:
We analyzed uric acid with the Salimetrics Salivary Uric Acid Assay kit (Salimetrics, Carlsbad, CA, USA). We mixed 10 uL of sample with 190 uL of uric acid reagent in duplicate following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shivanand Hegde, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 min 3% bleach+0.01% Coverage Plus NPD (Steris Corp.), 5 min in 70% ethanol then rinsed three times in sterile water ...
-
No products found
because this supplier's products are not listed.
Xiangpeng Sheng, et al.,
bioRxiv - Microbiology 2023
Quote:
... and cyclopiazonic acid (T15027) was from TargetMol Chemicals Inc.
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Alexander E. Vlahos, et al.,
bioRxiv - Bioengineering 2020
Quote:
... mycophenolic acid (Myfortic, Novartis) and FTY-720 (fingolimod, Biorbyt). ALS was administered as a single i.p ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Ioannis Kanakis, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Samples were processed with Clip-Clap™ Acid Pyrophosphatase (Cambio, UK) prior to the library preparation to remove any 5’ cap structures ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Josua Oderbolz, et al.,
bioRxiv - Immunology 2021
Quote:
... M25 peptide (amino acid sequence: NHLYETPISATAMVI) was purchased from EMC microcollections (Tübingen, Germany) and 20 μg of the M25 peptide in 0.5% DMSO in 1x PBS solution were injected i.v ...
-
No products found
because this supplier's products are not listed.
Anna V. Kellner, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Tannic acid-modified 8.8 nanometer gold nanoparticles (AuNPs) were custom synthesized by Nanocomposix. Cy3B-NHS (# PA63101 ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... At least two sections per mouse were stained with an acid-fast stain (Diagnostic BioSystems) according to the manufacturer’s instructions and visualized by an Olympus BH2 light microscope.
-
No products found
because this supplier's products are not listed.
Ionel Sandovici, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Insulin levels in acid–ethanol supernatants were measured using ELISA kits (Mercodia – 10-1247-01). Total pancreas insulin content (pmol/L ...
-
Anna V. Kellner, et al.,
bioRxiv - Bioengineering 2024
Quote:
... mPEG (# MF001023-2K) and lipoic acid PEG (LA-PEG, # HE039023-3.4K) were purchased from Biochempeg. Sulfo-NHS-acetate (# 26777) ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Shoib S. Siddiqui, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3’-sialyllactose-PAA-biotinylated (Glycotech, Catalogue number-01-038), diluted in binding buffer ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
Endo180-Fc expression vector was generated by subcloning a PCR amplified cDNA encoding soluble human Endo180 (amino acid residue 1-1394) (19) into the HindIII site of pGH-hFc expression vector (GenHunter Corporation) to allow in-frame fusion to human IgG Fc ...
-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
No products found
because this supplier's products are not listed.
Shouka Parvin Nejad, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The insoluble elastin content of oxalic acid digested samples was measured using the FastinTM Elastin Assay Kit by Biocolor (Accurate Chemical and Scientific Corporation ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...