-
No products found
because this supplier's products are not listed.
Ning Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... One mM final concentration of H-Bpa-OH (Chempep) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Adam G. Maynard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and resuspended in 150 μl of porphyrin extraction buffer (1:4 ratio of 1.7 M HCl:ACN, 1μM deuteroporphyrin IX (Frontier Scientific, D510-9)) and 0.5 μM isotopically labeled amino acids (Cambridge Isotopes ...
-
No products found
because this supplier's products are not listed.
Patrícia Dias Carvalho, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
No products found
because this supplier's products are not listed.
Ritesh K. Aggarwal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Genomic DNA was used to measure percent cytosine modification to 5-methylcytosine using a one-step ELISA method (cat# 1030, Epigentek). Manufacturer’s protocol was followed to quantify the amount of modified cytosine residues in 50 ng of genomic DNA per treatment condition ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Dinesh Balasaheb Jadhav, Sougata Roy,
bioRxiv - Physiology 2023
Quote:
... About 4 μg of peptides were loaded on a trap column (ChromXP C18CL 5 µm 120 Å, Eksigent, SCIEX) and online desalting was performed with a flow rate of 10 µl per minute for 10 min ...
-
No products found
because this supplier's products are not listed.
Marion Thauvin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and luciferase activity was measured every 1 h over 4 h with a 96-well plate luminometer (Tristar, Berthold) as described in the HiBit assay kit (Promega).
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Theodora U. J. Bruun, et al.,
bioRxiv - Biochemistry 2022
Quote:
... were coated with antigen at 1 μg/mL in 50 mM bicarbonate pH 8.75 for 1 h at room temperature then blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA buffer (Chondrex). In the case of biotinylated antigens ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Olivia M. S. Carmo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit α0801 (1:1000, gift from T. de Koning Ward and P. Gilson [9]), rabbit αMESA (1:1000 ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 4: (S)-2-amino-6-((2-azidoethoxy)carbonylamino)hexanoic acid (LysN3, Iris Biotech GmBH); 5 ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Mary S. Dickinson, et al.,
bioRxiv - Immunology 2022
Quote:
... supplemented with 9% heat inactivated FBS (Omega Scientific) and non-essential amino acids (Gibco 11140-050) ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
WB,ELISA
Cat# A5074, SKU# A5074-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Syed Arif Abdul Rehman, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The supernatant was incubated for 1 h with Ni-NTA- agarose (Expedeon), then washed five times with 10 volumes of the lysis buffer and then twice in 50 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Ana Izabel Silva Balbin Villaverde, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... The membrane was blocked (1 h at room temperature) and incubated overnight at 4°C with rabbit polyclonal antibody raised against EL (orb100394, LIPG; Biorbyt) at a dilution of 1:500 in 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Jeroen M. Bugter, et al.,
bioRxiv - Cell Biology 2024
Quote:
... followed by 1 h incubation with 25 µL Protein A-agarose beads (RepliGen). Beads were washed five times with 0,1 x PBS after which beads were eluted in SDS sample buffer and incubated for 30 min at 37°C.
-
No products found
because this supplier's products are not listed.
Megan G Jackson, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... rats were water restricted for a period of 4 h and were then placed in test cages containing two sipper sacks (Avidity Science) for 1 h ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Blots were blocked in blocking buffer for 1 hour at room temperature and probed overnight at 4°C for PER2 (1:1000 in 5% BSA and TBST; Alpha Diagnostic Intl., Inc., #PER21-A), BMAL1 (1:1000 in 5% BSA and TBST ...
-
No products found
because this supplier's products are not listed.
Nuria Masachs, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
No products found
because this supplier's products are not listed.
Philip Dettinger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... slides coated for 1 h with 10 µg/mL anti-CD43-biotin (MEM-59, ExBio) in PBS ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Yijuan Ding, et al.,
bioRxiv - Pathology 2020
Quote:
... 9 and 12 hpi were observed with a scanning electron microscope (JEOL JEM-6390LV).
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Dhiraj Kumar Singh, et al.,
bioRxiv - Immunology 2020
Quote:
... specimens were incubated with rabbit SARS CoV-2 spike (S) antibody (ProSci, USA, 1:200, 37°C for 2 h) or anti-SARS CoV-2 nucleocapsid (N ...
-
No products found
because this supplier's products are not listed.
Emily G. Kuiper, et al.,
bioRxiv - Biochemistry 2019
Quote:
... aeruginosa PAO1 EF-Tu (tufB) coding sequence from plasmid pJP04 (9) into the pE-SUMO vector (LifeSensors). This construct produces His6-SUMO-EF-Tu protein (“SUMO-L0-EF-Tu” ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Heejoo Kim, et al.,
bioRxiv - Immunology 2020
Quote:
... H-Rink-Amide-ChemMatrix (RAM) was purchased from Biotage. N,N-diisopropylethylamine (DIEA) ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Corinne S. Wilson, et al.,
bioRxiv - Neuroscience 2021
Quote:
... One-minute perfusate fractions were collected into scintillation vials using an automated fraction collector Spectra/Chrom CF-1 (Spectrum Chemical, New Brunswick, NJ, USA). After the last minute of collection ...
-
No products found
because this supplier's products are not listed.
Alexandra Zak, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica beads (5 × 106; 5 μm diameter; Bangs Laboratories) were washed in distilled water (5,000 rpm ...
-
No products found
because this supplier's products are not listed.
Yan Wu, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... the 9-week-old male J:NU mice were anesthetized with isofluorane and secured in a stereotaxic frame (RWD Life Science, Shenzhen, China), and a hole of the size of the needle was drilled through the skull ...
-
No products found
because this supplier's products are not listed.
Dennison Trinh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... DV −7.3 mm from Bregma according to the rat brain atlas using stereotaxic surgery at an infusion rate of 0.25 μL/min (4 μL total volume) using a 1 cc glass syringe (Hamilton Company, USA) and microinjector (Stoelting Co. ...
-
No products found
because this supplier's products are not listed.
Skye R.S. Fishbein, et al.,
bioRxiv - Microbiology 2019
Quote:
... One microgram of each of the fractions was injected on a 75um ID Picofrit column (New Objective, Woburn, MA) packed with Reprosil-Pur C18-AQ 1.9um beads (Dr ...