-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Jennifer McDonald, Catherine J. Merrick,
bioRxiv - Microbiology 2021
Quote:
Mature schizont cultures at >6% parasitaemia were synchronised using 55% Nycodenz (Alere technologies AS). Cultures were centrifuged and media removed to leave 2ml of media and blood ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Chandani Sen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... we used a high aspect ratio vessel (HARV) bioreactor vessel (model: RCCS-4H; Synthecon, Houston, Texas) of 2 ml volume and added 0.5 ml of functionalized microbeads and 1.5 ml of media containing a total of 1 million cells ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Maho Nakazawa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plasma histamine and mMCP-6 levels were measured using a histamine EIA kit (Bertin Bioreagent, Montigny-le-Bretonneux, France) and Mcpt6 ELISA kit (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Ryutaro Ariyoshi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and MTG mutant was purified with size exclusion chromatography using ProteoSEC-D 16/60 6-600 HR (Protein Ark) with PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microglia interleukines production was analyzed the same way with the Mouse Interleukin 6 ELISA Kit (Biosensis®, BEK-2043-1P) and the Mouse Interleukin 10 ELISA Kit (Biosensis® ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Hélène Neyret-Kahn, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The ends of the DNA fragments were ligated to double stranded barcoded DNA adapters (NEXTflex ChIP-Seq Barcodes - 6, #514120, Bioo Scientific) using T4 DNA Ligase ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Giovanni S. Offeddu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
MVNs were cultured using Vasculife Endothelial Medium (LL-0003, Lifeline) and pooled HUVECs (GFP-expressing, Angio-Proteomie, 6 million ml-1 after five passages) and nHLFs (Lonza ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Yakun Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... We also used archived normal NHP tissue lung sections (from one rhesus macaque and one cynomolgus macaque) purchased from Zyagen (San Diego, CA) as controls.
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Erin E Fowler, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 2D study mammograms were acquired from one of six Hologic (Hologic, Inc., Bedford, MA) mammography units ...
-
No products found
because this supplier's products are not listed.
Sarah Howald, et al.,
bioRxiv - Physiology 2021
Quote:
... The magnetic stirrers were connected to one stirrer controller (Rank Brothers Ltd., Cambridge, England). The chamber was closed with a custom-made glass lid with three metal ports ...
-
No products found
because this supplier's products are not listed.
Yuta Fujii, et al.,
bioRxiv - Plant Biology 2020
Quote:
One-day-old gemmalings were incubated in temperature-controlled incubators (IJ100, Yamato Scientific Co., LTD) and light conditions were adjusted using blue light-emitting diodes (LEDs ...
-
No products found
because this supplier's products are not listed.
Candice B. Herber, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4’-trihydroxychalcone were obtained from INDOFINE Chemical Company (Hillsborough ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... to check for variability over time and ii) a one-way (GVS: LGVS vs. RGVS vs. Sham) ANOVA on the averaged proprioceptive drift values of the two visual capture conditions ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Seeds harvested approximately one month after the transformation were screened on Murashige & Skoog (MS) medium plates (PhytoTechnology Laboratories) supplemented with hygromycin B (PhytoTechnology Laboratories ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Haoyang Chen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... One tube (left side in Fig. S5a) was filled with defibrinated bovine blood (Lampire biological laboratories, Pipersville, PA, USA) while circulated using a peristatic pump (model 3386 ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Zhifen Cui, et al.,
bioRxiv - Microbiology 2021
Quote:
... were generated by simultaneously mixing one volume of lipid mixture (25 : 5: 19.3 : 0.8 : 50 molar ratio) of DLin-MC3-DMA (MedKoo Biosciences, #555308), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine ...
-
No products found
because this supplier's products are not listed.
Fatima Abbas, et al.,
bioRxiv - Neuroscience 2023
Quote:
The mutated toxin AaH-IIR62K was the one described in a previous report [26] and it was produced by Smartox Biotechnology (Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Meilin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... four parts MRS+CQ broth was combined with one part Cleanascite™ Lipid Removal Reagent (Biotech Support Group #X2555-10) and shaken (220 rpm ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...