-
No products found
because this supplier's products are not listed.
Daniel P Myatt, et al.,
bioRxiv - Biophysics 2022
Quote:
... (6) using plasmid DNA purchased from Aldevron, UK with the reaction optimised as per the design-of-experiment (DOE ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 10 ng/mL mrIL-6 (Gemini bio-products). Cells were harvested ...
-
No products found
because this supplier's products are not listed.
Peter Njenga Ng’ang’a, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 6 × 104 cells in 1 mL DMEM medium (Pan Biotech) were grown for 48 h before addition of 5.8 nM of toxin ...
-
SIRT inhibitor
Sold for research purposes only.
Cat# 2249.0, SKU# 2249-25 mg,
25mg, US $401.50 / EA, EURO, €365 / EA
Ask
Vittoria Marini, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mesoderm differentiation (day 0) was induced using 6 μM CHIR99021 (Axon Medchem) for 48 hours in a chemically defined medium consisting of RPMI 1640 (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Alexey Kolodkin, et al.,
bioRxiv - Systems Biology 2019
Quote:
... PC12 (2×105 cells/well) were plated in 6-well plates (EuroClone) pre-coated with poly-L-lysine (0.1 mg/ml) ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Lea, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Vitrified blastocysts (day 5 and day 6) were thawed using the vitrification thaw kit (Irvine Scientific; 90137-SO) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Takaoki Kasahara, et al.,
bioRxiv - Genomics 2022
Quote:
... or 6 along with its flanking intron regions containing appropriate restriction enzyme sites was synthesized (Biomatik or Genewiz). Each exon of mouse Asmt gene in pcDNA5-FRT-TO was replaced with the human form using the appropriate restriction enzymes ...
-
No products found
because this supplier's products are not listed.
Barun Das, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 100 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (AdipoGen Life Science, San Diego, CA) was added to the culture media simultaneously with tamoxifen treatment.
-
No products found
because this supplier's products are not listed.
Biliana Marcheva, et al.,
bioRxiv - Cell Biology 2021
Quote:
... RNA was extracted from Beta-TC-6 cells and pseudoislets using Tri Reagent (Molecular Research Center, Inc, Cincinnati, OH) and frozen at ™80°C ...
-
No products found
because this supplier's products are not listed.
Somnath Shee, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C with rolling at 6 RPM in a roller incubator (120 Vac Roll-In Incubator; Wheaton, Millville, NJ). Cultures grown to OD600 ≈ 0.2 were harvested by centrifugation (4000 g for 5 min ...
-
No products found
because this supplier's products are not listed.
Debora L. Gisch, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Liquid nitrogen or OCT embedded frozen kidney tissue from 6 donors was processed according to a modified protocol adapted from Epicypher and available on protocols.io47 ...
-
No products found
because this supplier's products are not listed.
Philip Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-week-old C57BL/6 mice were injected intracranially into the right cerebral hemisphere using a 1ml Hamilton syringe with Repeating Syringe Dispenser (Hamilton Company, Reno, NV). Inocula contained 0 ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... Liposomes containing either PI(4)P (Echelon Biosciences) or PI(4,5)P2 (Echelon Biosciences ...
-
Carbohydrate
Cat# GMS0176S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Christina Strauch, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and nuclei were visualized using 4’,6-diamidino-2-phenylindole (DAPI) in mounting medium (SCR-038448; Dianova, Hamburg, Germany).
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Mary V. Arrastia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the nuclei concentration was assessed by loading 6 µL of the solution into a disposable hemocytometer (4-Chip Disposable Hemocytometer, Bulldog Bio, #DHC-N420, Portsmouth, NH). After determining nuclei concentration ...
-
No products found
because this supplier's products are not listed.
John F. Tuddenham, et al.,
bioRxiv - Neuroscience 2022
Quote:
6 µM tissue sections were deparaffinized with CitriSolv Clearing Agent (Decon Laboratories, Inc., 1601) for 20 min at room temperature (RT) ...
-
No products found
because this supplier's products are not listed.
Sanjoy Paul, et al.,
bioRxiv - Microbiology 2022
Quote:
... with intermittent vortexing of 30 seconds at setting 6 (Vortex Genie 2 Scientific Industries) every 2 min ...
-
No products found
because this supplier's products are not listed.
Arash Farhadi, et al.,
bioRxiv - Bioengineering 2019
Quote:
... cells cultured in 6-well plates were lysed with 400 µL of Solulyse-M (Genlantis Inc) per well for one hour at 4 °C ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Xiaofei Cao, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Samples were loaded with 6 μl of buffer A into a 50 cm fused silica emitter (New Objective) packed in-house with ReproSil-Pur C18-AQ ...
-
No products found
because this supplier's products are not listed.
Alina Remeeva, et al.,
bioRxiv - Biophysics 2021
Quote:
... with the mutation C85A and C-terminal 6×His tag) was obtained as a synthetic gene from Evrogen (Russia) and introduced into the pET11 expression vector (Novagen ...
-
No products found
because this supplier's products are not listed.
Catarina J. Gaspar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were transfected with fluorescent reporter constructs (1 μg total DNA/well, 6 well plate) using GenJet (SignaGen Laboratories) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Emily S. Bellis, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Czech Republic; CAS: 151716-18-6) or (±)orobanchol (Olchemim; CAS: 220493-64-1) at 0.01 µM and (±)-GR24 (Chempep, Wellington ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... the mechanosensitive cation channel inhibitor (e.g., Piezo1, TRPC1/6) GsMTx4 (Abcam or Peptide Institute, 2.5 μM, 15-min incubation)l the intracellular calcium chelator BAPTA-AM (Tronto Research Chemicals ...
-
No products found
because this supplier's products are not listed.
Jugal Kishore Das, et al.,
bioRxiv - Immunology 2022
Quote:
... male C57BL/6 mice were injected with an emulsion of 100 µl of chick type II collagen (Chondrex; 100 µg) in Complete Freund’s Adjuvant (CFA ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Sofia Nasif, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2×105 cells per well were seeded into a 6-well plate and transfections were performed using the Lullaby transfection reagent (OZ Biosciences). Transfection complexes were prepared in Opti-MEM™ (Gibco ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... One step luciferase assay kit from BPS Bioscience was used for detection ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Javeed Ahmad, et al.,
bioRxiv - Immunology 2021
Quote:
... and Wizard Classic 4 (Rigaku). Conditions for Sb16–RBD were either 0.1M HEPES pH 7.0 ...
-
No products found
because this supplier's products are not listed.
L Pérez-Sisqués, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice sacrificed one week after behavioral testing with FD Rapid GolgiStain™kit (FD Neurotechnologies) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Luca Tadini, et al.,
bioRxiv - Plant Biology 2019
Quote:
... AtHsc70-4 antibody from Antibodies-online, RpoTp (PHY0835S ...
-
No products found
because this supplier's products are not listed.
Ramona Haji-Seyed-Javadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
ChIP assay was performed using ChromaFlashTM One-Step ChIP Kit (P-2025, Epigentek, Farmingdale, NY, USA) according to the manufacture’s instruction ...
-
No products found
because this supplier's products are not listed.
Carissa L. Sirois, et al.,
bioRxiv - Genetics 2020
Quote:
... Gold enhancement was performed for 4 min using GoldEnhance (Nanoprobes). Cells were rinsed in deionized water to stop enhancement reaction.
-
No products found
because this supplier's products are not listed.
Cerys S Manning, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Western blots were performed using 4-20% Tris-glycine acrylamide gels (NuSep), Whatman Protran nitrocellulose membrane (Sigma ...