-
No products found
because this supplier's products are not listed.
Bethany A. Stahl, James B. Jaggard, Alex C. Keene,
bioRxiv - Neuroscience 2019
Quote:
Gaboxadol (4,5,6,7-retrahydroisoxazolo[5,4-c]pyridin-3-ol hydrochloride, THIP hydrochloride; Sigma Aldrich, St. Louis, MO, USA, # T101) was dissolved in dH2O at 1 mg/ml ...
-
No products found
because this supplier's products are not listed.
Rafiquel Sarker, et al.,
bioRxiv - Physiology 2022
Quote:
... BPTU (1-(2-(2-(tert-butyl)phenoxy)pyridin-3-yl)-3-(4-(trifluoromethoxy) phenyl) urea was from Tocris Bioscience.
-
No products found
because this supplier's products are not listed.
Hey-Kyeong Jeong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... differentiated OLs at 6 DIV (‘OL 3 days’) were transfected with plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
R. Christopher D. Furniss, et al.,
bioRxiv - Microbiology 2021
Quote:
... the covalent DsbB inhibitor 4,5-dichloro-2-(2-chlorobenzyl)pyridazin-3-one (final concentration of 50 μM) (Enamine) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Benedetta Sposito, et al.,
bioRxiv - Immunology 2022
Quote:
... gasderminC-2/-3 (Rabbit monoclonal; 229896; Lot# GR3317481-6; abcam), gasdermin D (Rabbit polyclonal ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Carla Julia S. P. Vieira, et al.,
bioRxiv - Genomics 2024
Quote:
... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
No products found
because this supplier's products are not listed.
Laura Giorgi, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DPPC) and Ergosta-5,7,9(11),22-tetra-3beta-ol (dehydroergosterol, DHE) were purchased from Avanti Polar Lipids Inc (Alabaster ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Suvadip Mallick, et al.,
bioRxiv - Microbiology 2019
Quote:
... 6-diamidino-2-phenylindole (Vector Laboratories Inc.) and observed under Zeiss Apotome microscope at the specified magnification ...
-
No products found
because this supplier's products are not listed.
Jessica E. Davis, et al.,
bioRxiv - Genomics 2019
Quote:
OLS libraries (Agilent Technologies, Santa Clara, CA) were resuspended to a final volume of 200 nM in TE pH 8.0 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Bidisha Mitra, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
No products found
because this supplier's products are not listed.
Angela B Schmider, et al.,
bioRxiv - Cell Biology 2019
Quote:
... (N-{(2S,4R)-4-(Biphenyl-2-ylmethyl-isobutyl-amino)-1-[2-(2,4-difluorobenzoyl)-benzoyl]-pyrrolidin-2-ylmethyl}8-3-(4-(2,4-dioxothiazoldin-5-ylidenemethyl)-phenyl]acrylamide (cPLA2 inhibitor, cPLA2 Inh, Calbiochem, EMD Biosciences), was used concomitantly with priming at 5 μM and MK-886 (FLAP Inh ...
-
No products found
because this supplier's products are not listed.
Rajagopal Ayana, et al.,
bioRxiv - Neuroscience 2021
Quote:
... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
No products found
because this supplier's products are not listed.
Tereza Kořánová, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PAK1/2/3 (Cell Signaling, #2604), and β-actin (Sigma–Aldrich ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Davide Sala, et al.,
bioRxiv - Genetics 2021
Quote:
... 6-diamidino-2-phenylindole (Hoechst; Roche, Rotkreuz, Switzerland) for nuclei ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Gang Du, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 µL 10 mM N-[6-(biotinamido)hexyl]-3′-(2′-pyridyl dithio)propionamide (biotin-HPDP, Cayman Chemical Company, 16459) in DMSO was added to each sample ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Yiming Fang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3×105 OVCAR3 cells were seeded with 3×105 CAFs in 6-well ultra-low attachment plates (Corning). At the time of seeding ...
-
No products found
because this supplier's products are not listed.
Vidhya M. Ravi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The fixed sections were covered with propan-2-ol (VWR, 20842312). Following evaporation for 40 seconds ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Samaresh Malik, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6-diamidino-2-phenylindole (DAPI) (Electron Microscopy Sciences, #17985-10) and viewed by confocal microscope (Leica SP8 ...
-
Cat# HY-W013035-500 mg,
500 mg, USD $50.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 1H, 1H, 2H, 2H-Perfluorohexane-1-ol (4:2-FTOH, CAS 2043-47-2, purity ≥ 97%) were from TCI America (Portland ...
-
No products found
because this supplier's products are not listed.
Oumeng Zhang, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1.5 NA TIRF objective lens (OL, Olympus UP-LAPO100XOHR) and an achromatic tube lens (TL ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Sofia E. Luna, et al.,
bioRxiv - Genetics 2024
Quote:
2-3 days post-electroporation HSPCs were plated in SmartDish 6-well plates (cat.: 27370; STEMCELL Technologies, Vancouver, Canada) containing MethoCult H4434 Classic or MethoCult H4434 Classic without EPO (cat. ...
-
No products found
because this supplier's products are not listed.
Bella Koltun, et al.,
bioRxiv - Neuroscience 2019
Quote:
... C57BL/6 WT pregnant dams 2-3 months of age were obtained weekly from local vendors (Envigo RMS, Jerusalem, Israel). Arc:dVenus mice (with a C57BL/6 background) ...
-
No products found
because this supplier's products are not listed.
Ning Tsao, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
No products found
because this supplier's products are not listed.
Timothy J. Mottram, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
No products found
because this supplier's products are not listed.
Robert C. Klipp, John R. Bankston,
bioRxiv - Biophysics 2022
Quote:
... pulled to a resistance of 2–6 MΩ (P-1000; Sutter Instrument) and filled with an internal solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Flora Magnotti, et al.,
bioRxiv - Immunology 2021
Quote:
... 20H (5-β-pregnan-3-α-ol, #P7800-000), Sulphate (5β- pregnan-3α-ol-20-one sulphate, sodium salt, #P8168-000) were from Steraloids. Tetrahydrocortisol (#T293370 ...
-
No products found
because this supplier's products are not listed.
Katalin Zboray, et al.,
bioRxiv - Molecular Biology 2023
Quote:
All VOCs were purchased from Sigma-Aldrich (except for (5Z)-octa-1,5-dien-3-ol from Toronto Research Chemicals) in the highest available purity ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 6 (3M and 6M, mIPSCs), respectively.
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Dong Wang, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...