-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... N,N,H,-trimethyl-5-[(tricyclo[3.3.1.13,7]dec-1-ylmethyl)amino]-1-pentanaminiumbromide hydrobromide (IEM-1460; HelloBio); 4-(3-(cyclopentyloxy)-4-methoxyphenyl)pyrrolidin-2-one (rolipram ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Xinyu Xie, et al.,
bioRxiv - Immunology 2024
Quote:
... 6-diamidino-2-phenylindole ( DAPI) (Solarbio, C006, China) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Benjamin Furtwängler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with growth factors (Miltenyi Biotec, IL-3, IL-6 and G-CSF (10 ng/mL), h-SCF and FLt3-L (50 ng/mL) ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Nathan C. Winn, et al.,
bioRxiv - Physiology 2022
Quote:
... and digested in 6 ml of 2-mg/mL type II collagenase (Worthington # LS004177) for 30 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Boštjan Kokot, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-(2-aminoethylamino)propyltrimethoxysilane (AEAPMS, Alfa Aesar), lacy carbon film supported by a 300-mesh copper grid (Ted Pella ...
-
No products found
because this supplier's products are not listed.
Joan Sebastián Gallego-Murillo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... respectively (CASY Model TCC; OLS OMNI Life Science; Germany; or Z2 Coulter Counter; Beckman Coulter; Indianapolis, IN). Population fold change (FC ...
-
No products found
because this supplier's products are not listed.
Cristina Esteva-Font, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... DAPI (4’,6-diamidino-2-phenylindole, MP Biomedicals, Solon, OH) was added at 300 nM for 15 min ...
-
No products found
because this supplier's products are not listed.
Liam McCarthy, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
No products found
because this supplier's products are not listed.
Abbas Jabermoradi, et al.,
bioRxiv - Biophysics 2021
Quote:
... into the back focal plane of the objective lens (OL, CFI Plan Apo Lambda 100x Oil NA 1.45, Nikon). The sample was placed on 3D printed coverslip sample holder and secured in place with small magnets ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Monique J. Ryan, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 µL of plasma was vortex mixed with 90 µL of propan-2-ol containing internal standards from Lipidyzer™ Internal Standard kit (SCIEX, MA, USA), SPLASH® LipidoMIX® (Sigma-Alridich ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
... HAPECs (passage 2-6, ScienCell, Carlsbad, CA) were incubated with 0.1 ng/mL interleukin-1 beta (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Chhiring Lama, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 6-diamidino-2-phenylindole (Spectral DAPI, Akoya Biosciences) was applied per provided protocols to label nuclei ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
6 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P06-1.5H-N,
20/case, $249.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Monika Chodasiewicz, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Thermal unfolding of G-actin (2 μM) and F-actin (2 μM) was performed with the Tycho NT.6 (Nanotemper, Munich, Germany) according to the manufacturer’s instructions in G-buffer (5 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
AJ Brandner, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... a set of eight monofilaments at logarithmic intervals from 0.008 to 6 grams (0.008, 0.023, 0.07, 0.16, 0.4, 1, 2, and 6 grams; Stoelting, Wood Dale, IL) were applied to the center of the plantar surface of the left hind paw for up to 4 seconds using the up–down method (Chaplan et al. ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Erin E. Henninger, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×30 seconds at 6 M/s and zirconium/silica beads (BioSpec Products 11079105z). Next ...
-
3-Methyl-2-buten-1-ol (Prenol, Prenyl alcohol, Dimethylallyl alcohol) is an endogenous metabolite.
Cat# S3123, SKU# S3123-100mg,
100mg, $97.00
Ask
Morteza Roodgar, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and then treated for 2 days with 6 μM CHIR99021 (Selleck Chemicals) in RPMI/B27 supplement without insulin to activate WNT signaling and induce mesodermal differentiation ...
-
No products found
because this supplier's products are not listed.
Lucas Busta, et al.,
bioRxiv - Plant Biology 2024
Quote:
... (v/v 2:1) with 10 μM 13C(6)-tyrosine (Cambridge Isotope, CLM-1542-0.25) as an internal recovery standard ...
-
No products found
because this supplier's products are not listed.
Yue Qu, et al.,
bioRxiv - Neuroscience 2021
Quote:
The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Dongyang Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... BMDMs were plated in 6-well plates (2×105 cells/well) and treated with 1 ng/mL LPS and 20 ng/mL mIFNγ (Sino Biological Inc., Beijing, China) for 24 h ...