-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Kaamini M. Dhanabalan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50:50 and 65:35) of different molecular weights from 10,000 - 85,000 Da having carboxylic acid end groups were purchased from Akina (AP041) (West Lafayette ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Esther Martínez-Martínez, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and B (0.5% acetic acid in 80% acetonitrile; LGC Standards-Promochem, Wesel, Germany) with increasing organic proportion was used for peptide separation ...
-
No products found
because this supplier's products are not listed.
Beibei Wu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Isolates were cultured on Middlebrook medium for 4-6 weeks at 37°C and DNA was extracted using magnetic beads (Tiangen Biotech Co., Ltd.). Rifampicin and isoniazid drug-susceptibility testing was performed using the proportion method in Löwenstein-Jensen medium (Aziz et al ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... amino acids (5 eq) were activated with N,N′-diisopropylcarbodiimide (DIC, 5 eq, Oakwood Chemical)/Oxyma (5 eq ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
John F. Tuddenham, et al.,
bioRxiv - Neuroscience 2022
Quote:
6 µM tissue sections were deparaffinized with CitriSolv Clearing Agent (Decon Laboratories, Inc., 1601) for 20 min at room temperature (RT) ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Alexander O. Bradley, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The cells were exposed to 6 Gy radiation from the X-ray tube (Rad Source Technologies, USA) at a fixed dose rate of 1.15 Gy/min.
-
No products found
because this supplier's products are not listed.
Zheng Han, et al.,
bioRxiv - Bioengineering 2019
Quote:
... into a 6-ml ISOLUTE® Single Fritted Reservoir column with 10 μm polyethylene frit (Biotage, Charlotte, NC, USA), followed by washing with 5 mL PBS ...
-
No products found
because this supplier's products are not listed.
Emily S. Bellis, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Czech Republic; CAS: 151716-18-6) or (±)orobanchol (Olchemim; CAS: 220493-64-1) at 0.01 µM and (±)-GR24 (Chempep, Wellington ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... The plate was left to incubate for 6 hours followed by addition of the ESF-AF medium (Expression systems). Sf9 cells were left for seven days at 27 °C without agitation ...
-
No products found
because this supplier's products are not listed.
R. Benjamin Free, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 5,6,7,8-tetrahydro-6-[(2-phenylethyl)propylamino]) derivative labeled with a red fluorescent probe (PPHT-red) was obtained from Cisbio Bioassays (Bagnolssur-Cèze ...
-
No products found
because this supplier's products are not listed.
Valerie Vargas-Zapata, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the selection was started by culturing cells in media containing 5 ug/mL blasticidin (AG Scientific, B-1247). The selection was continued for 7 days to allow non-transduced cells to die and be removed from the population ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H5,
1.0 ea, USD $1915.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Debora L. Gisch, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Liquid nitrogen or OCT embedded frozen kidney tissue from 6 donors was processed according to a modified protocol adapted from Epicypher and available on protocols.io47 ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Miryam Adelfio, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Gingival cells were maintained in culture up to passage 6 in appropriate medium supplemented with associated growth factor kits (Lifeline Cell Technology, Frederick, MD). For passaging cells ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... B.1.351 (Beta; Cube Biotech # 28721), P.1 (Gamma ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, W. Scott Moye-Rowley,
bioRxiv - Genetics 2021
Quote:
... or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% μg/ml nourseothricin (Jena Bioscience ...
-
No products found
because this supplier's products are not listed.
Joshua A. Broussard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse U100 anti-desmocollin 1a/b (Progen, 65192); mouse anti-vinculin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Antwi-Boasiako Oteng, et al.,
bioRxiv - Physiology 2021
Quote:
... non-esterified fatty acids (Wako Diagnostics), and cholesterol (Cholesterol E ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...