-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Mahmoud M. Elguindy, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Chromosome enumeration probes for chromosome 7 (CHR7-10-GR) and chromosome 20 (CHR20-10-RE) were purchased from Empire Genomics. Cells were trypsinized ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Frøydis Sved Skottvoll, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 6-MAM-d6 and morphine-d3 were purchased from Cerilliant (Austin, TX, USA). Unless otherwise stated ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Nejla Ozirmak Lermi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
DNA methylation analysis of the MLH1 gene was performed on DNA from frozen tissue samples of 7 tumors and 3 normal tissue (duodenum and blood) samples using a targeted NGS assay (EpigenDx, Hopkinton, MA). In brief ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Raegan Paul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... temperature and pH were measured directly in the fluids using a portable YSI Plus 6-Series Sonde Multimeter (YSI Incorporated, Yellow springs, OH) and 0.5 to 1.5 liters of hydrothermal fluids venting from the subsurface were collected ...
-
No products found
because this supplier's products are not listed.
Lone Buchwaldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mycelium plugs were cut with a 7 mm cork borer from the margin of actively growing cultures and placed on 3 × 7 cm pieces of stretched Parafilm (Bemis Company Inc, Oshkosh, WI, USA) with the mycelium facing up ...
-
No products found
because this supplier's products are not listed.
Giovanni S. Offeddu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
MVNs were cultured using Vasculife Endothelial Medium (LL-0003, Lifeline) and pooled HUVECs (GFP-expressing, Angio-Proteomie, 6 million ml-1 after five passages) and nHLFs (Lonza ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Changzheng Song, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (±)-GR24 (rac-GR24, CAS No: 76974-79-3) and Karrikin1 (KAR1, CAS No: 857054-02-5) were purchased from Chiralix (Nijmegen, Netherland). GR244DO was obtained from StrigoLab (Torino ...
-
No products found
because this supplier's products are not listed.
Jennifer Eng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Formalin-fixed paraffin-embedded (FFPE) human tissues were sectioned at 4-5 microns and mounted on positively charged slides (Tanner Adhesive Slides, Mercedes Medical, TNR WHT45AD). The slides were baked overnight at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Anastasiya Klebanovych, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the coding sequence of mNeonGreen was digested out from the mNeonGreen-EB3-7 plasmid (Allele Biotechnology, San Diego, CA) by BamHI/NotI ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and fractions 7 through 23 were collected using an automated fraction collector (Izon Science Ltd, 500 µL per fraction). A high sensitivity BCA assay (Pierce ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-Luciferin free acid (Prolume). The neutralization half-maximal inhibitory concentration (IC50 ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled A*0201 dextramer negative control (Immudex, 1:5). Antibodies for western blot ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
6-Formylindolo(3,2-b)carbazole is a small molecule which can act as an AhR agonist, endogenous....
Cat# abx076605-1MG,
1 mg USD $203.0
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...