-
No products found
because this supplier's products are not listed.
Elodie Darbo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or CCG-100602 (10787, CAS:1207113-88-9, Bertin Bioreagent, Montigny le Bretonneux, France). Cells were incubated at 37°C for 72h ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Danielle J. Sisnett, et al.,
bioRxiv - Immunology 2023
Quote:
... and normal healthy endometrium (n=9) using a total RNA purification kit (17200, Norgen Biotek Corp., Canada) as per manufacturer’s protocol ...
-
Cat# F10,
USD $18.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Rodney M. Ritzel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and resuspended in an intracellular antibody cocktail containing cytokine antibodies (MMP-9-R-PE, StressMarq Biosciences (SMC-396D); TNF-PE-Cy7 ...
-
No products found
because this supplier's products are not listed.
Feng He, et al.,
bioRxiv - Cell Biology 2020
Quote:
... in methanol:chloroform (9:1 v/v) solvent was loaded on to 0.45 µm supported nitrocellulose membrane (GVS, Sanford, ME). The membrane was air-dried for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Patrícia Aline Gröhs Ferrareze, et al.,
bioRxiv - Microbiology 2020
Quote:
... manual correction of genes from chromosomes 9 and 14 was performed with the software Artemis (Carver et al., 2012), the R265 genome (NCBI assembly GCA_002954075.1) ...
-
No products found
because this supplier's products are not listed.
Nina M. van Sorge, et al.,
bioRxiv - Microbiology 2020
Quote:
... The complex was concentrated to 9 mg/mL and screened against the commercial Wizards I/II/III/IV (Rigaku) and JCSG+ (QIAgen ...
-
No products found
because this supplier's products are not listed.
Celeste Riepe, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from the 9 sublibraries were combined into 500 mL Micro-Carrier Spinner Flasks (Bellco Glass, Vineland, NJ, Cat#1965-02500) such that each sgRNA library was represented at 1000X (e.g. ...
-
No products found
because this supplier's products are not listed.
George Sharbeen, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human patient-derived PDAC CAFs at passage 9 (PSC line 1 in Figure 1B) were immortalised by lentiviral delivery of a human telomerase expression construct (GenTarget, Cat. LVP1131-RP). Cells were maintained in puromycin selection and red fluorescent protein positive cells sorted on a BD FACS Aria II cell sorter ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Yukika Kawabata-Sakata, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with intact gonads were reared for 9 days in water containing 250 ng/ml of the AR antagonist cyproterone acetate (CA) (LKT Laboratories, St. Paul, MN) and 100 ng/ml of KT ...
-
No products found
because this supplier's products are not listed.
Autumn R Tobin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Linghao Hu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES, 10 μm, ASTATECH, A11656) was added to the cells in CM3 1 hour before imaging (35) ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Ke-Hsuan Wei, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Intraperitoneal (IP) injections of 10 μl PBS and Clodronate liposomes (5 mg/ml) (Liposoma, Amsterdam, The Netherlands) in each fish were performed according to the experimental design.
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Alexander A. Choi, Limin Xiang, Wan Li, Ke Xu,
bioRxiv - Biophysics 2023
Quote:
... the coverslips were functionalized with 10 mg/mL methoxy PEG silane (5 kDa, M-SLN-5000, JenKem Technology) in 95% ethanol/water for 30 min ...
-
No products found
because this supplier's products are not listed.
Amber M. Johnson, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... After blocking with 10% goat serum in equal parts of 5% BSA in TBST and Superblock (ScyTek Laboratories, AAA999) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Ru-pin Alicia Chi, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... which began with intraperitoneal administration of 5 IU of pregnant mare’s serum gonadotropin (catalog no. 493-10-2.5, Lee Biosolutions), followed by 5 IU of human chorionic gonadotropin (catalog no ...
-
No products found
because this supplier's products are not listed.
Andre L. P. Tavares, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
No products found
because this supplier's products are not listed.
Takushi Shimomura, et al.,
bioRxiv - Biophysics 2022
Quote:
In PI(3, 5)P2-injection experiments, 5 mM PI(3, 5)P2–diC8 (Echelon Biosciences) was manually injected by positive pressure using the glass needle filled with the PI(3 ...
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Masato Morita, Reo Higashi, Shin-ya Kawaguchi,
bioRxiv - Neuroscience 2023
Quote:
HEK293T cells were cultured at 37 °C in humidified air containing 5 % CO2 in DMEM (Nakalai Tesque, Kyoto, Japan) supplemented with 10 % (v/v) FBS (NICHIREI BIOSCIENCES, Tokyo, Japan) and penicillin (100 U/mL)-streptomycin (0.1 mg/mL ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Pedro A. Avila-Lopez, et al.,
bioRxiv - Genomics 2024
Quote:
... The cells were cross- linked with 6 mM disuccinimidyl glutarate (DSG; ProteoChem) for 30 min followed by crosslinking with 1% formaldehyde for an additional 10 min at room temperature and quenched with 125 mM glycine (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kosuke Toyoda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... HA (MBL International, #561-5), α-Tubulin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Konstantin F. Tirronen, Anastasiia S. Kuznetsova,
bioRxiv - Zoology 2023
Quote:
... 5 μL Screen Mix (Evrogen), 1 μL of each primer (10 μM ...
-
No products found
because this supplier's products are not listed.
Luke A. Pattison, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 10 µl complete Freund’s adjuvant (CFA, 10 mg/ml, Chondrex) or saline was injected unilaterally (ipsilateral knee randomly determined) ...
-
No products found
because this supplier's products are not listed.
Andrew M. Larey, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 10% FBS (Neuromics), 1% penicillin/streptomycin (Gibco) ...
-
No products found
because this supplier's products are not listed.
Garth Blackler, et al.,
bioRxiv - Physiology 2023
Quote:
... and further decalcified for 6 days in Formical-2000 (StatLab, PC-1314-32). Decalcified tissue was processed ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
MI Oliveira da Silva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in TBS-T or 5%BSA (NZYTech) in TBS-T for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Charles D Cox, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the cells broken with a TS5/48/AE/6□A cell disrupter (Constant Systems) at 31,000□psi at 4°C ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Subashika Govindan, et al.,
bioRxiv - Neuroscience 2020
Quote:
10 μl pipette (Rainin, #17014388)
-
No products found
because this supplier's products are not listed.
Yejin Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 10 ng of PRKACA (SignalChem) was incubated with 5 µg of huntingtin in a buffer containing 50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 µg cholera toxin (List Labs; 100B) in PBS ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
Catarina J. Gaspar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were transfected with fluorescent reporter constructs (1 μg total DNA/well, 6 well plate) using GenJet (SignaGen Laboratories) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jessica P. Yactayo-Chang, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Proteins were separated via SDS-PAGE on 10% precast mini-gels (Expedeon) with a Tris-MOPS buffer ...
-
No products found
because this supplier's products are not listed.
Jens C. Luoto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... both packed with 5 μm ReproSil-Pur 200 Å C18 silica particles (Dr. Maisch HPLC GmbH). The peptides were separated using a 60 min gradient (5-42 % B in 50min ...