-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Akinobu Senoo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Hit 1 was purchased from Vitas-M Laboratory ...
-
No products found
because this supplier's products are not listed.
Igor P. Oscorbin, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mg/mL Proteinase K (SibEnzyme, Russia)) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Tonia K. Tsinman, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Alcian Blue (1%, pH 2.5, Rowley Biochemical) Toluidine Blue (0.025% solution ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Madhur Kalyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... tb (0.1ml) were inoculated with 1:1 diluted blood (0.9 ml) in 7ml endotoxin free Sterilin Bijou tubes (Dynalab corporation, USA) and cultured for 4 days at 37ºC with slow shaking at 80 rpm.
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 μl of Taq-plus polymerase (NanoHelix, Korea), and 2.5 μl of 10 μM forward/reverse primer ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... heparan sulfate (1 μg/mL, Galen Laboratory Supplies). The final medium was comprised of basal media containing human TGF-β2 (2 ng/mL ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Andrew D. Weems, et al.,
bioRxiv - Cell Biology 2022
Quote:
VitroGel coffins were prepared by embedding MV3 or A375 cells in VitroGel 3D or RGD at 1:1 dilution according to manufacturer’s instructions (TheWell Biosciences, sku # TWG001). Briefly ...
-
No products found
because this supplier's products are not listed.
Taylor Russo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and rabbit polyclonal anti-glycosyslceramide (Glycobiotech #RAS_0010, 1:3,000). Primary antibody was detected with HRP-linked donkey anti–rabbit IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Chloe G Myers, et al.,
bioRxiv - Cell Biology 2024
Quote:
... or IGF-1 (25, 50, 100 nM, GroPep Bioreagents), at different doses for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... rabbit anti- histone H2A (1:1,000; 11-7017, Abeomics), rabbit anti-pS10-histone H3 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Amalia J. Napoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Larvae were mounted in 1% High EEO agarose (Crystalgen) molds [37] ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Pirunthan Perampalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cytokeratin (human specific cytokeratin 7 and 8, ZETA Corporation #Z2018ML, 1:200), EpCAM (Cell Signaling Technologies ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...
-
No products found
because this supplier's products are not listed.
Kirit Singh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Cryopreserved PBMCs from healthy donors and from glioblastoma patients were then thawed into PrimeXV T-cell expansion media (FujiFilm) supplemented with 3% of human platelet lysate (hPL, Compass Biomedical) and pelleted at 300g for 10 min ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Shauni L. Geeraerts, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... washing step and Annexin V (IQ Products IQP-120R, 1:100 in binding buffer) staining for 15 min at RT in the dark ...
-
No products found
because this supplier's products are not listed.
Shouka Parvin Nejad, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Sections were then fixed with 100% ACS grade acetone (Caledon Laboratories, cat #1200-1) for 2 minutes before air drying for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
Peptide to PAR-3 (1-6) (Human)
Cat# CCP2734,
1 mg USD $100.0, 5 mg USD $250.0, 10 mg USD $375.0
Ask
Huy-Dung Hoang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The following primary antibodies and corresponding dilution were used: 1:500 α-INPP5E (# CPA3073, Cohesion Biosciences), 1:10,000 α-β-actin (#A5441 ...
-
No products found
because this supplier's products are not listed.
Lucas T. Laudermilk, et al.,
bioRxiv - Genetics 2020
Quote:
... Zfp30+/+ and Zfp30-/- mice were sensitized with 10 μg Der p 1 (Indoor Biotechnologies, Charlottesville, VA) administered through intraperitoneal injection (in 100 μl of PBS ...
-
No products found
because this supplier's products are not listed.
Ruhi Patel, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... plated on solid NGM supplemented with 8 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, Laguna Scientific), and incubated for 16 to 24 h at 25° C ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Machmouchi Dana, et al.,
bioRxiv - Microbiology 2024
Quote:
... ZIKV infectivity was assessed using the mouse anti-E protein mAb 4G2 (RD-Biotech, Besançon, France). Antibody donkey anti-mouse Alexa Fluor 488 IgG (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Alex Quintero-Yanes, Aurélie Mayard, Régis Hallez,
bioRxiv - Microbiology 2022
Quote:
... Temperature (30 °C) was maintained stable during microscopy analysis using the Tempcontrol 37-analog 1 channel equipment (HemoGenix®) coupled to the Axio Imager Z1 microscope ...