-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
Cat# IMS206-EColi,
USD $199.0/20.0tests
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Amy Cheung, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% Bovine Serum Albumin in TBST for 2 hours (mouse anti-SERT 1:7000, MAb Technologies, ST51-2 ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Sanghwa Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and then immunoblotted using anti-HY5 (Abiocode, Cat. R1245-2, dilution 1:3000), anti-NRT1.1 (Agrisera ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
Hexokinase-1/2/3 (HK1/2/3) Antibody is a Mouse Monoclonal antibody against Hexokinase-1/2/3 (HK1/2/3).
Cat# abx137731-5UG,
5 µg USD $261.0
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
Cat# G209,
USD $10.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 2×104 Target cells were seeded into 96 well E-Plate (ACEA Biosciences Inc.) and rested overnight ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
Cat# 70374-51-5,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Scott P. Souza, et al.,
bioRxiv - Immunology 2021
Quote:
... and blocked with coating buffer containing with 1% BSA (w/v) and 2% goat serum (Omega Scientific) in PBS ...
-
No products found
because this supplier's products are not listed.
Dorit Möhrle, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... 2) KD (weight ratio of fat to carbohydrate plus protein is approximately 6.3:1, F3666, Bio-serv, NJ). Percentage calories provided by each nutrient category are ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 6-(Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite was purchased from Glen Research (CAS ...
-
No products found
because this supplier's products are not listed.
Frauke Muecksch, et al.,
bioRxiv - Immunology 2022
Quote:
Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Pallab Pradhan, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-CD3/CD28 bead (Dynabeads)-activated PBMCs (MSC/PBMC at 1:2) from healthy volunteers (purchased from Zen-Bio) plated in 200 ul culture media (RPMI 1640 + 10% FBS + 1% PS+ 30 IU/mL IL2 ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Kento T. Abe, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were washed three times with 200 μl PBS-T and blocked for 1-1.5 hr at room temperature with 200 μl 3% BSA (BioShop Canada Inc. #SKI400.1, lot #9H61850). After washing as above ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Svetlana Glushakova, et al.,
bioRxiv - Biophysics 2022
Quote:
... The mechanical activation of PIEZO1 in RBC by shear stress was achieved by constant agitation of cells (1-2 × 108 cells/ml) on the platform of a “Belly Button Shaker” (Model BBUAAUV15, Ibi Scientific) at a speed of 14 rpm ...
-
No products found
because this supplier's products are not listed.
Susan M. L. Banks, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Clathrin disassembly was initiated by adding 2 μM bovine Hsc70 preincubated with 1 mM ATP with or without 10 μM recombinant human α-synuclein (rPeptide), and monitored by dynamic light scattering using a Wyatt DynaPro ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
Native Antigen
Cat# NAT41589-100,
100µg USD $426.0
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Esteban J. Rozen, Kim Wgglesworth, Jason Shohet,
bioRxiv - Cancer Biology 2023
Quote:
... All cell lines were tested for Mycoplasma every 2 months using e-Myco™ Mycoplasma PCR Detection Kit (Bulldog Bio #25235), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A 1:1 Luminol and peroxide (Protein Simple) mixture was then added to generate chemiluminescent light ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Salla Kyheröinen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Phospho-Ser3 cofilin antibody (11139-1, 1:1000) was from Signalway antibody. The following secondary antibodies were from Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Maciej M. Jankowski, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the outer panels of every third section contain two nose-poke ports (Fig 2; a total of 12 ports in 6 sections, SPECIAL.090-SE v1.0, LaFayette-Campden Instruments, Loughborough, UK). One of the two ports in each section is connected to a liquid pump and the other to a pellet dispenser ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...