-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Claudia Carlantoni, et al.,
bioRxiv - Developmental Biology 2023
Quote:
24-well Plate Softwell Easy Coat hydrogels of different stiffness (0.1, 1, 2, 4 and 25 kPa, Cat #SS24-EC, Matrigen) were coated with 10µg/ml collagen I rat tail diluted in PBS (Cat #A10483-01 ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Jacqueline F. Rivera, et al.,
bioRxiv - Neuroscience 2023
Quote:
The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
Recombinant Antigen
Cat# DENVX4VLP-100,
4 x 100µg USD $3067.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
Cat# SA11000,
1mL SelfMag Amino Beads, USD $381.00/mL
Ask
Erica Tagliatti, et al.,
bioRxiv - Neuroscience 2019
Quote:
... For experiments in Fig.2 cortical neurons were transfected at 5 DIV with pAAV.hSynap.SF-iGluSnFR.A184V plasmid using Neuromag reagent (#KC30800, OZ Biosciences). This allowed expression of the iGluSnFR probe only in a small (∼ 3 – 5 % ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slices were in the chamber for 30 min with sucrose-based ACSF at 1-2 mL/min (#Minpuls 2, Gilson) and then NaCl-based ACSF (125 mM NaCl instead of sucrose ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Zhongxiao Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slices were perfused continuously with aCSF bubbling with 5% CO2/95% O2 at flow rate about 2 ml/min using two channels peristaltic pump (Dynamax, Rainin, USA).
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Zahra Mashhadi, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
No products found
because this supplier's products are not listed.
Kate M. MacDonald, et al.,
bioRxiv - Cell Biology 2022
Quote:
MCF10A cells were cultured in 1:1 mixture of F12:DMEM media supplemented with 5% horse serum (Wisent Bioproducts cat #098150), 20 ng/ml human EGF (Cedarlane Labs cat #AF-100-15) ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 ng/mL insulin (CELL technologies), 25 ng/mL hydrocortisone (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Xin Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (6 to 9 weeks) were decapitated in a restraining plastic cone (DecapiCone, Braintree Scientific) and the brains were dissected and immersed in ice-cold ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Olga Puchta, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Microarray imaging was performed in an imaging buffer solution containing fluorophore DFHBI-1T ((Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1Himidazol-5(4 H)-one) (excitation = 472 nm, emission = 507 nm)) from Lucerna Technologies Cat ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Layla Drwesh, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 °C) and the supernatants were incubated overnight with 2 mL Ni-NTA Agarose beads (Cube Biotech). The bound proteins were washed with 20 mL wash buffer (40 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Jasper Che-Yung Chien, et al.,
bioRxiv - Genetics 2020
Quote:
... and solutions of B02 (2×10-2 M; Abmole) and CAY10566 (CAY ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Jood Madani, et al.,
bioRxiv - Immunology 2023
Quote:
... they were treated with anti-PD-1 anti-CTLA-4 antibodies (clones RMP1-14 and 9H10, respectively, from Leinco Technologies Inc., Fenton, MO, USA): 200 µg ab/injection ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...