-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Sarah Chevalier, et al.,
bioRxiv - Neuroscience 2024
Quote:
... was placed in the OFC (AP: +3; ML: +2; DV: -5, in mm from bregma and dura) and a glass microelectrode (PG150-T, Harvard Apparatus, Holliston, MA, USA) filled with 0.4 M NaCl solution was lowered in the DMS (AP ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Mohit Rajabhoj, et al.,
bioRxiv - Plant Biology 2023
Quote:
... from 2 to 3-day-old WT and mea-1-/-;dme-2-/- seedlings using NucleoSpin® Plant II (MACHEREY-NAGEL). 200 ng of DNA was subjected to fragmentation using ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)(Research Products International) or acidic pH 6.5 media (26mM NaHCO3 ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Javier Garcia-Pardo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
No products found
because this supplier's products are not listed.
Chunfeng Mao, Maria Mills,
bioRxiv - Biophysics 2023
Quote:
... 0.25 mM PMSF) and eluted with 4 × 1 mL 0.15 mg/mL (50 µM) 3 x FLAG peptide (Chromotek). The elutant was concentrated with Amico-4 (50k MWCO ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Emmanuelle Grall, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Signal amplification was done with 1:50 TSA Plus Cyanine-3 or -5 (Akoya Biosciences) for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Luther M. Swift, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Samples were thawed on ice and phthalates were extracted from a 10 μL aliquot via vigorous vortexing for 30 min at 4°C in the presence of 5:3:2 methanol:acetonitrile:water (240 μL) containing an isotope labeled standard (1 μM DEHP ring-1,2-13C2, Cambridge Isotope Laboratories). Extraction supernatants were clarified via centrifugation at 18,000 rpm for 10 min at 4°C and analyzed immediately by ultra high-pressure liquid chromatography coupled to mass spectrometry (UHPLC-MS) ...
-
No products found
because this supplier's products are not listed.
Yuchen Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Organoid sections (4 µm) were probed with anti-cleaved caspase 3 (Biocare Medical) in 10% goat serum for 2 hours at room temperature and subsequently stained with Mach 1 Universal Polymer HRP ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Muscles were incubated overnight at 4°C with a rat IgG2a anti-MAC-2 (Galectin-3) antibody (1:250; clone M3/38; Cedarlane, cat# CL8942AP), then 2h at RT with a rabbit IgG anti-S100β antibody (1:250 ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Yusuke Nishimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
Akt1/2/3 inhibitor MK-2206 dihydrochloride (ApexBio, A3010), Rapamycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 3-100μM protease-activated receptor 4 agonist (PAR-4; Cambridge Biosciences); 0.03-3μM collagen-related peptide (CRP-XL ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
C Cintas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human pancreatic cell lines (Capan-1, BxPC-3, PANC-1, MIA PaCa-2) came from American Type Culture Collection (ATCC), human acute myeloid leukemia cell line (MOLM4 ...
-
No products found
because this supplier's products are not listed.
Christophe Caillat, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Yiran Li, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 □1 water and 5□1 MyTaq™ HS Mix (Bioline). RT-PCR was performed in the following conditions ...
-
No products found
because this supplier's products are not listed.
Gaëlle Hogrel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... These were diluted 2-fold with water and ultracentrifuged using 3 kDa MWCO spin filters (Pall). Liquid chromatography analysis was performed on the Dionex UltiMate 3000 system ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Yoann G. Santin, et al.,
bioRxiv - Microbiology 2023
Quote:
... manually back blotted for 3-4 secondes and flash-frozen in liquid ethane using a CP-3 plunger (Gatan). Data were collected on a 300-kV CRYO ARM™ 300 (JEM-Z300FSC ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ou Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 70 µL serum was applied to the human obesity array (RayBiotech, #QAH-ADI-3-2) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Jan Becker, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silicon gasket (Grace Bio-Labs CultureWell, 3 × 1 mm; U.S.) was laid on the coverslip to contain the sample ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Casimir Bamberger, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2xStrep tagged SARS-CoV-2 ORFs were immunoprecipitated using 30 μl of Megastrep type 3 XT beads (IBA LifeSciences, Germany), and flag-tagged SARS-CoV-2 ORFs were immunoprecipitated using Anti-DYKDDDDK Magnetic Agarose (Pierce ...