-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Francisco del Caño-Ochoa, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 ml of heat-inactivated FBS were dialyzed against 1 L of tap water for 1 day at 4°C using SpectraPor #3 dialysis tubing with a molecular weight cutoff of 3,500 Da (Spectrum Laboratories, Inc., USA), supplemented with NaCl (9 g per liter) ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The full cDNA sequence of the lncRNA was then amplified with forward primer: 5’- GTATCATAAGGATCCCTTTCCACTGCTCTGGTGAG-3’ and reverse primer: 5’- GTATCATAAGTCGACCTCACCTAGCTGTCTGTCC-3’ and cloned into pAAV-MCS (Cat#: VPK-410, Cell Biolabs Inc.) using the restriction enzymes BamH I and HindIII sites ...
-
No products found
because this supplier's products are not listed.
S. L. Fowler, et al.,
bioRxiv - Neuroscience 2023
Quote:
Pooled EV fractions 4–6 isolated from 0.8 g tissue were diluted 1:5 in PBS containing a 1:3 dilution of 10 nm gold-conjugated BSA (BBI solutions), applied to glow-discharged 2/2 μm holey carbon-coated 200-mesh gold grids (Quantifoil ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Mariève D. Boulanger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB, #BC24, G-Biosciences) in phosphate buffered saline solution (PBS ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Caroline Murawski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 2 µm S1818 (Microchem, 5000 rpm, baking at 100°C for 1 min). Patterns were developed for 40 – 50 s in MF319 (Microchem) ...
-
No products found
because this supplier's products are not listed.
Claudia Z. Han, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 mM EDTA)) for mechanical dissociation using a 2 ml polytetrafluoroethylene pestle (Wheaton, 358026)1 ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike (BPS Bioscience) and p24 (Abcam ...
-
No products found
because this supplier's products are not listed.
Brianna M. Doratt, et al.,
bioRxiv - Immunology 2023
Quote:
Freshly thawed UCBMCs (1-2×106 cells) were stained with Ghost Violet 540 (Tonbo Biosciences, San Diego, CA) for 30 min at 4C in the dark before being incubated with Fc blocker (Human TruStain FcX ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
Cat# 799261-92-0,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
Joshua Peeples, et al.,
bioRxiv - Plant Biology 2022
Quote:
... while run 3 and 4 were fertilized with 1.51mg of 15-5-15 + Ca + Mg Peters Excel mix fertilizer (ICL Specialty Fertilizers, Summerville SC) and 0.29g of ammonium sulfate were dissolved in the water applied to each rhizobox prior to mixing with the soil ...
-
No products found
because this supplier's products are not listed.
Sumin Jang, Elias Gunmit, Hynek Wichterle,
bioRxiv - Developmental Biology 2022
Quote:
... ISL1/2 (Goat, 1:5000 Neuromics GT15051), MNX1 (Guinea pig ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Rohit Singh Rawat, et al.,
bioRxiv - Neuroscience 2022
Quote:
... isolated from hypothalamus and PFC of F0 and F1 male mice was diluted in immunoprecipitation buffer and incubated with 2 μg 5-methyl cytosine antibody (A-1014; Epigentek) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... AKT1-2 inhibitor MK-2206 (Targetmol, 1032350-13-2), and everolimus (Targetmol ...
-
No products found
because this supplier's products are not listed.
Philipp Gaugler, et al.,
bioRxiv - Plant Biology 2022
Quote:
... They were then diluted 1:200 in 2 mL fresh medium supplemented with 6 μCi mL−1 [3H]-myo-inositol (30–80 Ci mmol−1; Biotrend; ART-0261-5) and grown overnight at 28°C in a spinning wheel ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Jing Zeng, et al.,
bioRxiv - Genetics 2023
Quote:
... and 100 ng ml-1 Preclinical FMS-like Tyrosine Kinase 3 Ligand (FLT3L) (CellGenix, cat# 1415-050). HSPCs were electroporated with 3xNLS-SpCas9:sgRNA or 3xNLS-HiFi- SpCas9:sgRNA RNP immediately ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plates were blocked with 3% bovine serum albumin (BSA, Fitzgerald) in PBS with 0.1% Tween-20 at 4℃ overnight ...
-
No products found
because this supplier's products are not listed.
Benjamin D. Gastfriend, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EZ spheres were passaged every Friday by mechanical dissociation with 2–4 passes on a McIlwain Tissue Chopper (Campden Instruments, Loughborough, United Kingdom), with half of the resulting aggregates returned to the flask and half discarded ...