-
No products found
because this supplier's products are not listed.
Bukola Adeoye, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasma levels of Herpes simplex virus 1/2 (HSV-1/2) and Clostridium tetani (tetanus)-toxoid-specific IgG were captured and measured with ELISA kits from Calbiotech and Alpha diagnostics according to manufacturers’ protocols.
-
Cat# H2G029,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sudeshna Saha, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5% CO2 and shaking at 200 rpm in presence or absence of 30 µM CMP-Neu5Ac (Nacalai USA. Inc.) until OD600 equivalent to 0.4– 0.5.
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% of the KH-103 in Captisol/DMSO was formulated in 20% Solutol (GLPBIO) in 0.9% sterile saline (Moltox) (w:v ...
-
No products found
because this supplier's products are not listed.
Penghao Xu, et al.,
bioRxiv - Genomics 2023
Quote:
... neutralization using 2 M HCl and purification using HighPrep™ RNA Elite Clean-up System (MagBio Genomics) was performed ...
-
No products found
because this supplier's products are not listed.
William J Dower, et al.,
bioRxiv - Immunology 2023
Quote:
... for 5-10 min at 25°C and the reaction was stopped using STOP solution (Surmodics Cat# LSTP-1000-01).
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Keli Lima, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... resuspended in 100 μL PBS containing 5 μL of PE-labeled anti-CD11b (clone MEM-174, EXBIO Praha, Vestec, Czech Republic) or 5 μL of APC-labeled anti-CD14 (clone TÜK4) ...
-
No products found
because this supplier's products are not listed.
Laura Martinez-Ruiz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Tumor pieces were digested using 5–10 mL of a 2.5 mg/mL Collagenase NB4 standard (S1745401 Nordmark Biochemicals, Uetersen, Germany) solution in PBS + 3 mM CaCl2 for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Elisa M Nabel, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were anesthetized with 2% isoflurane and head-fixed on in a mouse stereotactic apparatus (Narishige International USA Inc.) equipped with a heating pad ...
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Le Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Primary antibodies with final concentrations used for immunofluorescence staining: rabbit anti-SCGB1A1 polyclonal antibody [5 mg/ml] (WRAB-3950, Seven Hills Bioreagents), mouse anti-FOXJ1 monoclonal antibody [8 mg/ml] (14-9965-80 ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Chih-Jen Cheng, et al.,
bioRxiv - Physiology 2024
Quote:
... age- and gender-match littermates were anesthetized with 2% isoflurane and underwent osmotic minipump (Alzet model 1002, Durect, CA, USA) implantation subcutaneously into the neck ...
-
No products found
because this supplier's products are not listed.
Jared M. Fischer, et al.,
bioRxiv - Bioengineering 2024
Quote:
... whole blood (10 µL) was mixed with 2 mM EDTA (10 µL) and analyzed using the HemaVet 950S (Drew Scientific).
-
No products found
because this supplier's products are not listed.
Thomas F. Martinez, et al.,
bioRxiv - Genomics 2019
Quote:
... Fluorescein-labeled reference peptide KVFPC(FITC)ALINK was synthesized by covalently coupling of fluorescein to the cysteine residue with 5-(iodoacetamido)fluorescein (Marker Gene Technologies, M0638) for use in the HLA-binding assay ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Dennis Alejandro Escolástico-Ortiz, et al.,
bioRxiv - Microbiology 2023
Quote:
... followed by 1 h at 45°C and 2 h at 65°C in a heating block digestion system (DigiPREP, SCP Sciences). After digestion ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
... The resulting mix was incubated for 5 minutes at room temperature and then added to HCC827 cells adhered to 35 mm glass bottom Willco (WillCo Wells BV, Amsterdam, The Netherlands) dishes ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...