-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Olga Puchta, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Microarray imaging was performed in an imaging buffer solution containing fluorophore DFHBI-1T ((Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1Himidazol-5(4 H)-one) (excitation = 472 nm, emission = 507 nm)) from Lucerna Technologies Cat ...
-
No products found
because this supplier's products are not listed.
Limin Shang, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR reactions were performed with I-5™ 2×High-Fidelity Master Mix (MCLAB, TSINGKE Biological Technology, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Grace Ying Shyen Goh, et al.,
bioRxiv - Genetics 2022
Quote:
... and PUFAs (mix of fatty acid sodium salts: 150 μM C18:2, S-1127; 150 μM C20:5, S-1144, Nu-Chek Prep). E ...
-
No products found
because this supplier's products are not listed.
Mohd Sariq, Omkar, Geetanjali Mishra,
bioRxiv - Zoology 2023
Quote:
... Adults of both species were paired and placed in beakers separately under laboratory conditions (27 ± 2°C temperature; 65 ± 5% relative humidity; 14L:10D photoperiod in Biochemical Oxygen Demand Incubators; Yorco Super Deluxe, YSI-440 New Delhi, India) and were provided with ad libitum supply of aphids ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
HEp-2 slides (Antibodies Incorporated) were used according to manufacturer’s protocol with serum diluted 1:50 in 2% BSA in PBS ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2% Culture-Boost (Cell Systems), and 10% Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... 5 μl PPP Master Mix (Top-Bio) and 3 μl PCR H2O (Top-Bio) ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... RPA at 5 μM (ME043.1, Squarix biotechnology), MitoTracker Green at 75 nM (M7514 ...
-
No products found
because this supplier's products are not listed.
Nisha Dhanushkodi, et al.,
bioRxiv - Immunology 2022
Quote:
... HSV-2 DNA copy number was determined using purified HSV-2 DNA (Advanced Biotechnologies, Columbia, MD) and based on a standard curve of the CT values ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Jessica D. Warren, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Paclitaxel (Taxol) was used at 5 nM (Biotang). The following drugs were also used at the specified concentrations ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Benjamin A Nanes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5% bovine serum albumin (Equitech-Bio BAH65-0500), and 0.5% Triton X-100 (Sigma X100 ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Yeranuhi Hovhannisyan, et al.,
bioRxiv - Pathology 2023
Quote:
... and CW30318 (Control 2, Fuji Cellular Dynamics) derived from healthy individuals without any cardiac pathology ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Ting Pan, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Seeds were surface-sterilized and sowed on MS/2 medium (PhytoTechnology laboratories) (1% sucrose pH 5.7 ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Thibault Courtellemont, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5 OD600 units were transferred into 5 mL of SC-arginine/-lysine (Sunrise Science Products) supplemented with 0.43 mM arginine and lysine ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microdialysis probes (2 mm; 38 kDa molecular weight cut off; BR-style; BASi) were inserted into the guide cannula ...
-
No products found
because this supplier's products are not listed.
Daniel Abebayehu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... fibroblasts were cultured on 2 kPa polyacrylamide hydrogels that were purchased from Matrigen and came chemically activated ready to bind matrix proteins ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Adrian Kendal, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 7 % w/v polymer solution of PDO (Riverpoint Medical, Portland, Oregon , USA) in 1,1,1,3,3,3-Hexafluoro- 2-propanol (HFIP, Halocarbon Product Corporation ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Emily Speranza, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were de-waxed according to a standard protocol of 2 washes of Xylene (Newcomer Supply) for 10 minutes each ...
-
No products found
because this supplier's products are not listed.
Natalie J. Norman, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 999 ± 2 µg/ml in 0.2% (v/v) HNO3(CGC1) inorganic carbon standard (Inorganic Ventures, USA). All other chemicals and salts were trace metal grade (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... and SARS-CoV-2 RNA was extracted using FavorPrep Viral RNA Minikit (FAVORGEN, Ping-Tung, Taiwan), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Blasi Maria, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were then incubated with 2 μg/ml biotinylated rabbit anti-human IFN-γ (U-CyTech biosciences, Utrecht, The Netherlands) for 2 hours at room temperature ...