-
No products found
because this supplier's products are not listed.
Carly R. Mickelson, et al.,
bioRxiv - Neuroscience 2022
Quote:
... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Jennifer A Rybak, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
No products found
because this supplier's products are not listed.
Patrick C. Kerstein, et al.,
bioRxiv - Neuroscience 2020
Quote:
... (S)-1-(2-Amino-2-carboxyethyl)-3-(2-carboxy-5-phenylthiophene-3-yl-methyl)-5-methylpyrimidine-2,4-dione (ACET; 1μM; Tocris Bioscience, catalog #2728).
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Solveigh C. Koeberle, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Žiga Avsec, et al.,
bioRxiv - Genomics 2020
Quote:
... ɑ-Pbx 1/2/3 (Santa Cruz, sc-888), and ɑ-Zic3 (Abcam ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Jooyoung Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... for 2 min and 3% lead citrate (EMS, #22410) for 1 min ...
-
No products found
because this supplier's products are not listed.
Matilde Murga, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2 and 1 ng/ml murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA), respectively ...
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
Catherine F. Ruff, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were washed in 0.1M cacodylate buffer and postfixed with 1% osmium and 1.5% potassium ferrocyanide in cacodylate buffer for 1 hr at RT after sections were dehydrated in an ascending gradient of ethanol (ETOH ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Laura Micheli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... PlGF-2 (3 – 30 ng; 5 µl; cat.465-PL/CF, R&D System, USA), VEGF-E (3 – 30 ng ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Hua Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was amplified by PCR using the primers (5’-GGTTCCGCGTGGATCCATGTCTCATGCAGCCGAGCCA-3’ and 5’-GGAATTCCGGGGATCCTCAGGACTCCTCTTCAATGCTGA-3’) and cloned into BamHI site of pGEX-4T-1 expression vector (GE Healthcare) using In-Fusion HD Cloning System (Clontech) ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Katrin Linda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Medium was refreshed every 2-3 days and cells were passaged 1-2 times per week using an enzyme-free reagent (ReLeSR, Stem Cell Technologies). For autophagy induction cells were treated with 200 µM Rapamycin (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Katie G. Owings, Clement Y. Chow,
bioRxiv - Genetics 2023
Quote:
... 30 samples were collected (5 timepoints x 2 genotypes x 3 replicates) and RNA was extracted using a Direct-zol RNA Miniprep (Zymo Research R2061) using TRIzol Reagent (ThermoFisher Cat # 15596026 ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...