Labshake search
Citations for Roche :
1 - 50 of 8217 citations for 5 1 3 Dioxolan 2 yl 2 3 fluorobenzoyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, #11465007001) and CellTiter-Glo Luminescent Cell Viability (CTG ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Roche, Mannheim, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The cytotoxicity assays were performed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Roche, ref:11465007001) protocols according to the previous study [47] with few modifications ...
-
bioRxiv - Biochemistry 2024Quote: Cell metabolic viability was measured by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Roche). After treatments ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... included 1.11 μM N7XX (5′-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG-3′) and S5XX (5′-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC-3′) primers (384PP_AQBP) in 2× HiFi HotStart ReadyMix (Roche, KK2602, 6RES_GPSA). Dual barcode sequences in primers are denoted by “XXXXXXXX.” Unique dual barcode combinations for each well of a 384-well plate were achieved by dispensing 16 unique N7XX barcodes across each row and 24 unique S5XX barcodes across each column ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µg/ml of glycerol 3-phosphate dehydrogenase (Roche) and 5 µg of cell free protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Microbiology 2024Quote: rpoD was then amplified using psEG30F (5’-ATYGAAATCGCCAARCG-3’) and psEG790R (5’-CGGTTGATKTCCTTGA-3’) and KAPA2G Fast Hotstart Readymix (Roche-07960956001) to generate a 736 bp product as previously described (Girard et al ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... Real-time fluorescence-monitored quantitative PCR using the primer pair 5′-CCTATC ACCCTTGCCA-3′ and 5′-GAGGCTGTTGCTTGTG-3′ was performed on a LightCycler 96 System (Roche, Basel, Switzerland). Each reaction of 20 µL consisted of 10 µL of SYBR Green I (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche) in NTMT pH9.5 solution (100mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, #11383221001, Roche) and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in detection buffer ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate solution (Roche). Images were captured using a BX-50 microscope (Olympus Corp. ...