Labshake search
Citations for Eppendorf :
1 - 50 of 988 citations for 5 1 3 Dioxolan 2 yl 2 3 fluorobenzoyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... The adjacent 3-5 sections of 100 micron tissue sections were collected in a pre-chilled 2mL microcentrifuge tube (Eppendorf Protein LoBind Tube, Cat #22431102) to total a volume of approximately 40 mg for each donor ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...