-
No products found
because this supplier's products are not listed.
Kyra. J.E. Borgman, et al.,
bioRxiv - Immunology 2020
Quote:
... and Alexa Fluor 647 Carboxylic Acid succinimidyl Ester (Invitrogen). Antibody labelling reactions were performed by incubating a mixture of secondary antibody ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Huamei Forsman, et al.,
bioRxiv - Immunology 2024
Quote:
... The HCA3R agonists IBC 293 (1-(1-Methylethyl)-1H-benzotriazole-5-carboxylic acid) and 3-hydroxy-octanoic acid (3-OH-C8) were from Tocris (Bristol, UK) and Cayman Chemical (Michigan ...
-
No products found
because this supplier's products are not listed.
Samuel Shields, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Arvid Herrmann, et al.,
bioRxiv - Plant Biology 2024
Quote:
... kC9 and its phosphonic acid ester form (P-[[(Acetyloxy)methoxy]-2-naphthalenylmethyl]-bis[(acetyloxy)methyl] ester phosphonic acid: 1) are also commercially available (abcam AB141566 and abcam141567, respectively). These compounds were diluted in DMSO and subjected for chemical treatment ...
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
Primarily ribosomal RNA. Suitable substrate for ribonuclease assays.
Cat# LS003452,
100 mg, $68.00
Ask
Charley Mackenzie-Kludas, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 1 μg/ml L-1-tosylamido-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemicals). Plaque forming units (PFU ...
-
No products found
because this supplier's products are not listed.
Prakash Lama, Minhajuddin Sirajuddin,
bioRxiv - Biochemistry 2021
Quote:
Benzyl-guanine NHS ester (BG-GLA-NHS; NEB S2040) was covalently linked to the C7-amine modified oligonucleotide (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vaishali Aggarwal, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Qinyu Hao, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare) or Alexa FluorTM (AF ...
-
No products found
because this supplier's products are not listed.
Cristiane Miranda Franca, et al.,
bioRxiv - Bioengineering 2022
Quote:
... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
C.W.E. Embregts, et al.,
bioRxiv - Immunology 2021
Quote:
... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 14-3-3 (Cell Signaling, 8312S, 1:1,000).
-
No products found
because this supplier's products are not listed.
Jason Sims, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Magnetic beads (Dynabeads M-270 Carboxylic Acid) were activated and coated with ad hoc designed LNA probes (Qiagen), harboring an −NH2 group ...
-
No products found
because this supplier's products are not listed.
Shuai Xu, Yafeng Kang, Zhiqiang Liu, Hang Shi,
bioRxiv - Biophysics 2022
Quote:
... except that the carboxylic silica beads were replaced by polystyrene carboxylic beads and polyclonal anti-digoxigenin from sheep (11333089001, ROCHE) were used in our experiments.
-
No products found
because this supplier's products are not listed.
Rukmini Mukherjee, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Isolated proteins were digested with 1:50 w/w LysC (Wako Chemicals, cleaves at the carboxylic side of lysine residue) and 1:100 w/w trypsin (Promega, Sequencing-grade ...
-
No products found
because this supplier's products are not listed.
Suyash Naik, et al.,
bioRxiv - Biophysics 2020
Quote:
... 1% Tannic acid (EMS) and 1 % Uranyl acetate (EMS) ...
-
No products found
because this supplier's products are not listed.
Sarah Ennis, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Carboxyfluorescein succinimidyl ester (CFSE) (Biolegend) was dissolved in dimethyl sulfoxide (DMSO) ...
-
No products found
because this supplier's products are not listed.
Wenjuan Yang, et al.,
bioRxiv - Immunology 2021
Quote:
... Caffeic acid phenethyl ester (CAPE) (R&D Systems), Mitoquinone (MitoQ ...
-
No products found
because this supplier's products are not listed.
L. Michel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... dehydrated in methanol and cleared in Benzyl Alcohol/Benzyl Benzoate (1/2) prior to mounting and imaging with a SP8X confocal microscope (Leica). A 3D binary mask was built using Fiji to obtain a binary image of the tissue ...
-
No products found
because this supplier's products are not listed.
Valentina Vergara-Stange, et al.,
bioRxiv - Biochemistry 2024
Quote:
2,2-diphenyl-2-picrylhydrazyl (DPPH•) and 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox®) were purchased from Calbiochem (San Diego, California, USA), 2,2’-azobis(2-methylpropionamidine ...
-
No products found
because this supplier's products are not listed.
Weiwei Peng, et al.,
bioRxiv - Immunology 2023
Quote:
... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Amber L. Altrieth, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1% Acetic Acid (Polysciences) was pipetted directly onto the sections for one minute ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Odile Fabre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
No products found
because this supplier's products are not listed.
Yuxi Ai, Dongming Liang, Jeremy E. Wilusz,
bioRxiv - Molecular Biology 2021
Quote:
... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
No products found
because this supplier's products are not listed.
P Chaudhary, et al.,
bioRxiv - Neuroscience 2020
Quote:
... neurotrophin-3 (NT-3, 1 ng/ml, PeproTech, Rocky Hill, NJ), and ciliary neurotrophic factor (CNTF,10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Rasheduzzaman Rashu, et al.,
bioRxiv - Immunology 2023
Quote:
... with 50 μg of the Toll-like receptor (TLR)3 agonist polyinosinic-polycytidylic acid [poly (I:C)] (InvivoGen), 50 μg of the TLR7 agonist imiquimod (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Yan Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Unc13-3 (1:1000, Synaptic systems, 126303), Synpo1 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Nelson García-Vázquez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... LC-3 (1:5,000, Novus Biological NB100–2220), p21 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Tiancheng Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
We conjugated IRDye800 CW NHS ester (LI-COR Biosciences) and CF647 NHS ester (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Sally Martin, et al.,
bioRxiv - Genomics 2020
Quote:
... 1:100 B27 supplement without retinoic acid (Miltenyi Biotec) supplemented with 10 µM SB-431542 ...
-
No products found
because this supplier's products are not listed.
Adriano De Marino, et al.,
bioRxiv - Genomics 2021
Quote:
... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
No products found
because this supplier's products are not listed.
Connor J. Maltby, et al.,
bioRxiv - Neuroscience 2023
Quote:
... PFPSL7 (Abclonal, 1:100, Acid AR) were diluted in 5% NGS Tris B (Tris pH 7.6 ...
-
No products found
because this supplier's products are not listed.
Sean C Piantadosi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... tertiary streptavidin conjugated Cy-3 (1:250 Jackson lab)].
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Kelsey Barrasso, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3-day old suckling CD-1 mice (Charles River Laboratories) were fasted for 1 hour ...
-
No products found
because this supplier's products are not listed.
Yichao Zhao, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rabbit anti-pRPA2 (S33) (1:1000 for IB; Bethyl, A300-246A-3), mouse anti-CHK1 (1:1000 for IB ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...