Labshake search
Citations for Takara Bio :
1 - 50 of 1720 citations for 3 Chloromethyl pyrrolidine 1 carboxylic acid benzyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatants were harvested and mixed 1 to 3 with Lenti-X concentrator (Takara, 631232), cooled down to 4C for 30 minutes and spun down for 45 minutes at 4C.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA ...
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-caccgccatggtggcggatcccttgtacagctcgtccatgcc −3’) (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-cacgtctcatcccctccatctttgacctttcaaagtg - 3’) (Clontech). The full-length Tenm4 cDNA ...
-
bioRxiv - Immunology 2024Quote: ... and 3′-RACE CDS primer (Clontech). Next ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HRT for attaching GFP at the 3’ end of pan-1 was made by PCR (Takara PrimeStar Max) from plasmid pPD95.75 (Addene #1494 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Microbiology 2021Quote: ... complementary to the DENV 3’UTR at 65°C for 3 hrs using ExpressHyb hybridization buffer (Clontech). Autoradiographs were quantified using ImageQuant (GE Healthcare).
-
bioRxiv - Cell Biology 2021Quote: ... purified nucleic acids were treated with DNA enzyme I (Takara, Japan). RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... Cell lysates were quantified using the bicinchoninic acid assay (BCA, Takara). For each sample ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...