Labshake search
Citations for GenScript :
1 - 50 of 203 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed with Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript wesite (www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool ...
-
bioRxiv - Bioengineering 2022Quote: ... and gene expression was examined by real-time PCR using primer pairs (Genscript, Nanjing, China) and SYBR Green (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: ... Primer and probes (see below in Table S1) were designed using Real-time PCR (TaqMan) Primer and Probes Design Tool (online tool) from GenScript and synthesized by BioTez ...
-
bioRxiv - Neuroscience 2019Quote: ... miR-1002 negative scramble was ordered from Genscript for ligation into pAC-GAL4.
-
bioRxiv - Biochemistry 2020Quote: ... or mutant pre-miR-200c (Synthesized by Genscript) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Biophysics 2024Quote: ... a plasmid encoding 26X repeats of the miR-34a transcript (Genscript) was transcribed via T7 RNA polymerase (T7 RNAP ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Neuroscience 2021Quote: ... monomers and LPS were detected using endotoxin detection kit following the manufacturer’s protocol (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the QuickClean 5M PCR Purification Kit (GenScript, Piscataway, NJ, USA). NanoDrop ND-100 Spectrophotometer (NanoDrop Technologies ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Cell Biology 2022Quote: Wild type prkar2b subunit of bovine PKA and mutant prkar2b (harbouring mutations that ablate all potential miR-34c seed sites) were synthesized (GenScript) and cloned into pmaxGFP vector (LONZA) ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Immunology 2021Quote: Levels of neutralizing antibodies in serum samples were determined by cPASSTM SARS-CoV-2 neutralization antibody detection kit (GenScript, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Secondary assessment of the RBD-ACE2 interaction blocking potential of the isolated nanobodies was performed using the Genscript SARS-CoV-2 Neutralization Antibody Detection Kit (#L00847, Genscript) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peak fractions were resolved on 8–16% SurePAGE Bis-Tris (GenScript) gels.
-
bioRxiv - Immunology 2022Quote: ... PDB 7RNJ (16)) and produced in house starting from synthetic DNA (Genscript). The human IgG-like bispecific CoV-X4042 was designed based on the variable regions of antibodies sd1.040 and rbd.042 in the CrossMAb format (25) ...
-
bioRxiv - Molecular Biology 2024Quote: ... ancX-16 were codon optimized for Saccharomyces cerevisiae and synthesis by Genscript, China ...
-
bioRxiv - Genetics 2024Quote: ... and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript). Plasmids were checked by PCR for correct insert size and also by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... branching G and RT were also obtained from GenScript Corp ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids for the other 16 TTSPs and furin were purchased from GenScript and described earlier (13) ...
-
bioRxiv - Bioengineering 2023Quote: ... A pET29b expression plasmid encoding I53-50B.4PT1 16 was synthesized by GenScript using the NdeI and XhoI restriction sites with a double stop codon just before the C-terminal polyhistidine tag ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... The purified PCR products and linearized vectors were assembled using a GenBuilder Plus kit (Genscript, L00744-10) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... with an Applied Bio-Rad CFX96 Sequence Detection system (Genscript, NanJing, China) was used in the real-time PCR procedure ...
-
bioRxiv - Neuroscience 2019Quote: ... bromophenol blue) without reducing agent before loading onto a 4-16% PAGE gel (GenScript ExpressPlus™). Gels were blotted on PVDF membranes and fixed in 4% formaldehyde for 30 minutes and boiled in PBS for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... This mix (16 μL) was then loaded onto 15 μL of α-FLAG G1 resin (Genscript) pre-equilibrated in FLAG resin buffer (50 mM Hepes pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Cell Biology 2020Quote: ... a PshAI/XhoI cDNA fragment encoding normal CEL with 16 VNTR repeats was synthesized by Genscript and used to replace the corresponding segment in pcDNA3/CEL-WT 14R ...
-
bioRxiv - Immunology 2021Quote: ... protein was incubated overnight at RT with anti-FLAG resin (L00432, Genscript) to remove unreacted XCL1 ...
-
bioRxiv - Neuroscience 2019Quote: ... The GtACR1-EYFP fragment from the p7-GtCAR1 plasmid was swapped in using CloneEZ® PCR Cloning Kit (GenScript) for the myr::GFP fragment in pJFRC177 and the sequence was verified (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were run on gradient pre-cast SDS polyacrylamide gels (8-16%, ExpressPlu, GenScript, M81610, Piscataway, USA) before being transferred to nitrocellulose membranes (0.45μm ...
-
bioRxiv - Biophysics 2023Quote: ... NTS1 peptide encompassing the first 16 residues of its CTD (SANFRQVFLSTLACLC) purchased from from GenScript (>= 95% purity) was dissolved in 100% trifluoroethanol (TFE ...
-
bioRxiv - Plant Biology 2023Quote: The series of truncated ONSEN RT plasmids were created from a synthesized (GenScript) ONSEN-ALS cassette cloned into pUC57 ...
-
bioRxiv - Genetics 2021Quote: ... The predicted full-length lincRNA sequences were amplified by PCR and cloned into the pJR1-41XL vector (Moreno, Durán and Ribas, 2000) using the CloneEZ® PCR Cloning Kit (GenScript). Each plasmid was checked by PCR for correct insert size ...