Labshake search
Citations for GenScript :
1 - 50 of 163 citations for pVectOZ CAT Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... AAV production protocols were modified to include polyethylenimine co-transfection of an AAP-6 expression plasmid (ORF under the control of the CMV promoter, synthesized by GenScript Biotech), the variant 5 AAV cap plasmid ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... control Flag (A00187; Genscript) and total NF-κB (8242 ...
-
bioRxiv - Microbiology 2022Quote: ... Rabbit IgG Control (GenScript).
-
bioRxiv - Plant Biology 2022Quote: ... the aphid (Myzus persicae) effector Mp10 was used as a positive control 72 Flg22 (cat. no. RP19986, GenScript) was used as an inducer of ROS production ...
-
bioRxiv - Cell Biology 2020Quote: ... and a scrambled control peptide (GenScript) were used for addback experiments ...
-
bioRxiv - Molecular Biology 2020Quote: ... or vector control plasmids (Genscript, Piscataway, NJ) were diluted in Opti-MEM media (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... or corresponding species-appropriate IgG control antibody (GenScript), conjugated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Plant Biology 2021Quote: ... AtPIP and control gene coding sequences were commercially synthesised (Genscript) as gateway-enabled entry constructs and cloned into destination vectors from the Advanced Gateway® series of yeast expression plasmids (Alberti et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Cell Biology 2023Quote: ... corresponding cDNAs were subcloned under control of Actin5C promoter (GenScript). The resulting constructs had N-terminal Halo or EGFP tags (Nv-Osk ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCDNA3.1(+)-Hygro plasmids and empty vector control were purchased from Genscript and transfected with PEI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MYD88 inhibitor and control peptides were synthesised by GenScript (Hong Kong, China) with the following amino acid sequences with purity > 95%29,30 ...
-
bioRxiv - Molecular Biology 2019Quote: ... ATP1B1 was overexpressed by transient transfection using a pcDNA3-based construct from GenScript (#OHu18298D). Plasmid sequences and cloning details available upon request.
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Cell Biology 2022Quote: ... SpCas9 and guide RNA (gRNA) were expressed using transient transfection of px459 v2 expression vector (Genscript). Polyclonal cultures were obtained by puromycin selection prior to monoclone selection by serial dilution ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Cell Biology 2019Quote: ... and EphB1 panning (receptor antagonistic) peptide (EWLSPNLAPSVRGSGSK) and scrambled control peptide (RTVAHHGGLYHTNAEVK) were synthesized by GenScript. PCR primers were custom synthesized from Integrated DNA technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... All iOn and control piggyBac vectors were assembled in a pUC57-mini plasmid backbone (Genscript Inc) using a combination of DNA synthesis (Genscript Inc) ...
-
bioRxiv - Biochemistry 2023Quote: ... The empty vector control and specific point mutations of this plasmid were also generated by GenScript. Plasmids were transformed with Invitrogen’s One Shot Top10 chemically competent cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Biochemistry 2023Quote: ... All transfections were performed using full-length Rhinolophus ACE2 placed into a HDM plasmid (synthesized by GenScript). Transfection of ACE2 alleles into HEK293T cells was performed using 0.2 µg DNA and 0.15 µL Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... (GenScript, cat #OHu27639); rat MCT4 (rMCT4 ...
-
bioRxiv - Immunology 2020Quote: ... The iKIR (DTHFRTFRSHSDYRR) and scrambled-KIR peptide control (DTHFARTFARSHSDYRRI) were obtained from GenScript (Piñeros Alvarez et al., 2017). A lipophilic palmitoyl group was added to the N-terminus of both sequences to facilitate cell penetration (Waiboci et al. ...
-
bioRxiv - Biophysics 2022Quote: ... was purchased from Genscript (GenScript Cat# A01737, RRID:AB_2622222). Alexa Fluor 568 streptavidin was from ThermoFisher (Thermo Fisher Scientific Cat# S-11226 ...
-
bioRxiv - Immunology 2019Quote: ... M3 (RGFFRGG) and M3-scramble controls: M3-Sc1 (FGRGFRG) and M3-Sc2 (GFFGRGR) were synthesized by GenScript (Piscataway, NJ).
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Biophysics 2021Quote: pET-DUET expression plasmids containing the genes for barnase and barstar under the control of their own T7 promoter were obtained from GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids containing the N171 N-terminal fragment sequence of human HTT bearing either 85 CAG repeats (HTT85Q, pathological HTT fragment) or 10 CAG repeats (HTT10Q, control HTT fragment) were manufactured by GenScript and subsequently cloned into a transgene cassette flanked by viral inverted terminal repeats (ITRs) ...
-
bioRxiv - Biophysics 2022Quote: ... Labeled peptides with N-terminal tetramethyl Rhodamine (TMR): TMR-HK2p-CPP and control TMR-ScrP-CPP were synthesized by GenScript, Inc ...
-
bioRxiv - Microbiology 2022Quote: ... a gene SIRT7 (C-terminally 3xFLAG tagged) under the control of a CMV promoter in pcDNA3.1 was commercially synthesized (GenScript, USA). For transfection experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Molecular Biology 2024Quote: ... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
bioRxiv - Bioengineering 2023Quote: ... then cells were added at 3 × 105 cells per well for negative control (media only) and RABV-G or VZV-gE peptide pools (15-mers overlapping by 11; Genscript) (1 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: Streptavidin resin (GenScript, Cat. # L00353)
-
bioRxiv - Biochemistry 2020Quote: Glutathione resin (GenScript, Cat. # L00206)
-
bioRxiv - Biochemistry 2021Quote: Glutathione resin (GenScript, Cat. # L00206)
-
bioRxiv - Biochemistry 2021Quote: Streptavidin resin (GenScript, Cat. # L00353)
-
bioRxiv - Immunology 2021Quote: ... S1 (GenScript, Cat # Z03485-1) and RBD (aa 319-591 ...
-
bioRxiv - Molecular Biology 2022Quote: ... LDS buffer (Genscript, cat. M00676) mixed with B-mercaptoethanol was added to the samples and stored at -20°C.
-
bioRxiv - Immunology 2024Quote: ... or IgG (Cat #A01008, GenScript) were added and beads were rotated at 4°C for 5 hr ...
-
bioRxiv - Immunology 2019Quote: ... V3P and PF as well as control peptides NP366 (ASNENMETM) and P18-I10 (RGPGRAFVTI) were purchased from GenScript (Piscataway, NJ, USA). Antibodies 53-6.7 (anti-CD8α) ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of cell lysate was saved as an input control and the remaining cell lysate was incubated with Glutathione MagBeads (GenScript, L00327) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and N (GenScript, Cat No. A02090) were included at high (30µg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2020Quote: The codon optimized thermophilic lacZ gene (32) under the control of the GBL-responsive promoter srbAp or the strong constitutive promoter and ermEp* (GenScript, Nanjing, China) was cloned in the integrative vector pSET152 between NdeI and XbaI to yield the plasmids of pSET-srbAp-lacZ and pSET-ermEp*-lacZ ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the same amount of whole cell proteins extracted from a positive sample and a control sample were individually boiled with the gel-loading buffer (4×LDS, Genscript, Nanjing, China), and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript ...
-
bioRxiv - Cancer Biology 2024Quote: ... the same amount of whole cell proteins extracted from a positive sample and a control sample were individually boiled with the gel-loading buffer (4×LDS, Genscript, Nanjing, China), and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript ...