Labshake search
Citations for GenScript :
101 - 150 of 660 citations for Zinc Finger With KRAB And SCAN Domains 5 ZKSCAN5 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... of the human CRX protein was fused to a 6x His-tag inserted following the met start codon and subcloned into the commercial PMAL-c5x expression plasmid containing a maltose binding domain (MBD) coding sequence using Xmnl and EcoR1 restriction sites (GenScript, Piscataway, NJ). CRX DBD-MBD plasmid was transformed into BL21 E ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 10 amino acid sequences covering the four reported binding sites on the clathrin terminal domain (see Fig. 7A) were synthesized by GenScript (Piscataway, NJ) with > 95% purity ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biophysics 2023Quote: ... featuring wild-type HttEx1 with 32 consecutive glutamine residues within the polyQ domain was sub-cloned into a pMALc5x plasmid by Genscript (Piscataway, NJ), as previously described (9) ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Biochemistry 2021Quote: ... blots were washed thrice with TBST for 10min each and incubated with anti-rabbit HRP-coupled secondary antibody (Genscript, Cat. no. A00098, 1:2000) for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... the plates were washed with PBST four times followed by adding 100 µL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, NJ, USA; Cat # A00166) and incubating for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... plasmid containing a TEV-cleavable N-terminal His-tag and a 100 residue fragment comprising the NRG1-Ig domain (residues 34-133 of the UniProt Q02297 sequence) was purchased from GenScript (US distribution, Piscataway, NJ). This plasmid was transformed into BL21(DE3 ...
-
bioRxiv - Immunology 2021Quote: ... as well as anti- GAPDH– HRP conjugate (A00192; GenScript), incubations were carried out for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 100 µL of anti-rabbit IgG HRP conjugated (GenScript, USA) (1:30,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A horseradish peroxidase (HRP) labeled secondary against the His tag (Genscript) was added at a 1:5,000 dilution in 3% BSA in TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and detected with MonoRab™ Rabbit Anti-Camelid VHH Cocktail [HRP] (Genscript), diluted 1:500 in blocking buffer.
-
Modifications in the T arm of tRNA globally determine tRNA maturation, function and cellular fitnessbioRxiv - Molecular Biology 2023Quote: ... which were detected after incubation with 120 ng/mL streptavidin-HRP (Genscript) in hybridization buffer for one hour ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Cell Biology 2023Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript, United States) and SuperRX Fuji medical X-Ray films (Fuji FILM ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... anti-cGMP antibody (PerkinElmer anti-cGMP antibody: final dilution1:8000, Genscript anti-cGMP antibody ...
-
bioRxiv - Microbiology 2020Quote: ... and then incubated with 45 μL each of 0.1 μg/mL of THE anti-his-HRP (GenScript, A00612) in PBST/BSA for 1 hr at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Commercial antibodies tested also included a human IgG chimeric antibody from GenScript (SARS-CoV-2 spike S1 Antibody (HC2001), GenScript #A02038 ...