Labshake search
Citations for GenScript :
351 - 400 of 602 citations for Toll Like Receptor 5 TLR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were codon optimized to S. coelicolor A3(2) using Genscript’s OptimumGene™ algorithm (Supplementary Fig. 5) and then synthesized by Genscript. The stop codon removed rAPOBEC1 was fused to the N-terminus of the start and stop codons removed Cas9n (D10A ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Neuroscience 2020Quote: ... The crRNA (0.1nmole) was first annealed with an equimolar amount of transactivating crRNA (tracrRNA) in 5 µl in the annealing buffer (GenScript) by heating at 95°C for 5 min followed by rapid chilling ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Molecular Biology 2022Quote: ... The galanin-GAL1R-Gi complex was formed in membranes by the addition of 5 μM galanin peptide (synthesized by GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Microbiology 2022Quote: ... A sequence in which each CTD serine 5 residue was replaced by an alanine was ordered as synthetic gene (GenScript) and subcloned in place of the wild-type CTD sequence into the G2-CTD construct (G2-CTD-S5A) ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... 5) was designed using SnapGene software (from GSL Biotech; available at www.snapgene.com) and artificially synthesized by Genscript (Piscataway, NJ, USA). The length of upstream and downstream homology arms were 500 bp long and targeted the chitinase gene from AcMNPV ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... The CRISPR array extended with a BsrG1 restriction site at the 5’ end was synthesized in pUC19 (GenScript Biotech, Netherlands).
-
bioRxiv - Cell Biology 2019Quote: ... 20 µg of 30-mer oligo(dT) labeled with an NH2 group at its 5’-end (synthesized by Genscript, Nanjing, China) and 50 µg of Alexa Fluor 647 NHS ester (A37537 ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2019Quote: ... we designed and purchased an anti-horse-SLN polyclonal antibody from Genscript (pAb GS3379). The immunogen was a 6-residue N-terminal peptide of horse SLN (Q1MEWRRE6C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... EsxA and SodA were generated for this study (Customer’s Antigen Polyclonal Antibody Package, Genscript). C-terminally his6-tagged SiEsaA41-871 ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Microbiology 2020Quote: ... or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript). After washing 50 µL of TMB substrate (Tetramethylbenzidine ...
-
bioRxiv - Immunology 2022Quote: ... The polypeptide antibody against shrimp NLRP3 (aa29-42) was prepared by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Immunology 2022Quote: ... the standard curve was run using an IgG1 SARS-CoV-2 neutralizing antibody (GenScript) for full quantification ...
-
bioRxiv - Cell Biology 2022Quote: ... Slc37a2 peptide antibodies were produced using the PolyExpressTM service by GenScript (New Jersey, USA).
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... GrgA and mutants were detected using a monoclonal anti-His antibody (Genscript, Cat. A00186) and a mouse anti-GrgA antibody (35).
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blot analysis was performed using THETM DYKDDDDK Tag Antibody [HRP-conjugated] (A01428, GenScript) and Monoclonal Anti-polyHistidine−Peroxidase (A7058 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Biochemistry 2022Quote: ... The following phospho-specific antibodies were used: pS384-RPA70 (monoclonal, custom generated by Genscript), pS10-Histone H3 (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with an anti-EsxA1 rabbit polyclonal antibody (0.5 μg/ml; GenScript) in the above LI-COR blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The variable regions of heavy and light chains for each antibody were synthesized (GenScript), cloned into gWiz or pCDNA3.4 vector ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...