Labshake search
Citations for GenScript :
1 - 50 of 1119 citations for Thioredoxin Domain Containing Protein 3 TXNDC3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding N-terminal domain proteins were obtained from GenScript. Plasmids were transiently co-transfected in FreeStyle 293-F cells using 293Fectin (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric Plexin-B constructs containing Plexin-B1 and Plexin-B2 domain swaps were produced by Genscript. Target sequences for the ECD ...
-
bioRxiv - Biochemistry 2021Quote: ... The antibody variable domains of hybridomas 8E11 and 9C6 were sequenced by Genscript.
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biophysics 2022Quote: The C terminal domain of Influenza A Matrix protein 1 (M1C) was subcloned into pET15b vector (GenScript). In addition to the M1C sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the truncated version of Npnt containing only the N-terminal EGF-like repeats domain (Npnt-EGF) were commercially synthesized (Genscript) and cloned into the modified RCAS vector ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2022Quote: Fusion peptide domains (FP1, FP2 and FP1-FP2) of the SARS-CoV-2 spike protein were synthesized by GenScript with a purity ≥ 95% ...
-
bioRxiv - Molecular Biology 2023Quote: We chose gene fragments encoding complete deaminase domains as well as extra N and C protein sequences for commercial synthesis (GenScript) (fig ...
-
bioRxiv - Biochemistry 2022Quote: ... of the human CRX protein was fused to a 6x His-tag inserted following the met start codon and subcloned into the commercial PMAL-c5x expression plasmid containing a maltose binding domain (MBD) coding sequence using Xmnl and EcoR1 restriction sites (GenScript, Piscataway, NJ). CRX DBD-MBD plasmid was transformed into BL21 E ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Immunology 2023Quote: ... LY-CoV-1404/bebtelovimab antibody variable domain sequences were acquired from the structure reported in (45) and recombinant antibody was cloned and produced by Genscript. mAbs or ACE2 protein were first biotinylated using the EZ-Link Sulfo-NHS-Biotinylation Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Biochemistry 2023Quote: ... Follower and leader (clasp domain) peptides were synthesized by Genscript.
-
bioRxiv - Bioengineering 2021Quote: ... Codon-optimized cDNAs containing the effector protein RfxCas13d were synthesized (Genscript) and assembled into modified pET28 vectors by NEBuilder HiFi DNA assembly (E2621 ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Cancer Biology 2022Quote: ... sBRAF kinase domain constructs were purified using glutathione affinity resin (Genscript, catalogue ...
-
bioRxiv - Cell Biology 2023Quote: ... K916R mutant of the Rubicon RH domain was synthesized by Genscript in a pMAL-c5E vector.
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biochemistry 2020Quote: ... all PDZ domain coding sequences were inserted into the pET28a+ vector (GenScript) with an N-terminal His-tag and cleavable PreScission site ...
-
bioRxiv - Biophysics 2021Quote: ... Purified EGF-like domain of NRG1β was incubated with G1 Flag Resin (Genscript) for 1 hr at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biophysics 2022Quote: The peptide library spanning the tau repeat domain residues was synthesized from GenScript, ensuring each peptide was of sufficient purity (>90% ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2023Quote: ... that recognizes the epitope 833PEGMDPFAEKPNAT846 in the cytoplasmic domain of gB (GenScript Corp) 14 ...
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Constructs encoding USP21 catalytic domain with GS linker were made by GenScript (Nanjing, CN). Genes encoding WT mouse MLKL and PCR-derived mutants were cloned into pF TRE3G PGK puro ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biophysics 2019Quote: ... TRPV2 was eluted with Wash Buffer containing 0.006% DMNG and 3 mg/ml 1D4 peptide (GenScript USA) and subjected to size-exclusion chromatography using a Superose 6 column (GE Healthcare ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Immunology 2020Quote: The DNA sequences of the extracellular domains of ACE2 and IgG1 were synthesized by Genscript and cloned into pcDNA3.1 ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... GO grids were first incubated with 3 µL of 250 nM recombinant protein G (Genscript Z02007) in resuspension buffer ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Plant Biology 2020Quote: ... The sequence of the EXT domain from SlPEX1 (NCBI accession AF159296) was synthesized and cloned by GenScript into pUC57 (pUC57-EXT) ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the BCCR opsin domains optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... The sequence of the EXT domain from SlPEX1 (NCBI accession AF159296) was synthesized and cloned by GenScript into pUC57 (pUC57-EXT) ...