Labshake search
Citations for GenScript :
1 - 50 of 591 citations for TRNA cytosine 5 Methyltransferase TRDMT1 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... tRNA-guide4-tRNA and tRNA-guide4-tRNA-guide10-tRNA-guide18 sequences were synthesized by GenScript and were inserted at the HpaI and SmaI site by directional cloning.
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... The U6 promoter-tRNA cassette synthesized by GenScript was used as a template for the cloning ...
-
bioRxiv - Plant Biology 2023Quote: ... A gRNA scaffold-tRNA template was synthesized by GenScript and cloned into pBlueScriptII (SK ...
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Bioengineering 2023Quote: ... The tRNA–gRNA construct flanked by the BsaI restriction sites was synthesized by GenScript and ligated into the pRGEB32 vector ...
-
bioRxiv - Immunology 2024Quote: ... The biotin-K417N peptide (VRQIAPGQTGNIADYNYKLP ; GenScript) was mixed with the streptavidin-AF647 in a 4:1 ratio at room temperature for 2 hours ...
-
bioRxiv - Immunology 2020Quote: ... Biotin-Protein L was purchased from GenScript. BsiWI was purchased from New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... the cells were stained with Biotin-Protein L (Genscript) followed by fluorescently-conjugated streptavidin.
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides containing an N-terminal biotin tag were purchased from GenScript and dissolved according to manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2mg/ml BSA with either fixed or varying concentrations of either the peptide substrate (Biotin-GGGENWYNTLKRKK-NH2) (Genscript) or ATP spiked with 0.8μCi [γ 32P]-ATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2022Quote: ... Peptides were commercially synthesized and biotin-labeled on the N-terminus using Fmoc chemistry (GenScript, Piscataway, NJ, USA). Sequences of these peptides are shown in Table 1.
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Biochemistry 2021Quote: 1 µg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized fom Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Immunology 2021Quote: ... 1 μg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized from Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2022Quote: Substrate phosphorylation time course assays with PKD1ULD-5G/10G-KD were performed on ice with 50 nM protein and 100 µM biotinylated Syntide2 (biotin-PLARTSVAG (GenScript)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The blot was incubated with 10 μg/mL pre-biotin-CpOGACD for 1 h at room temperature followed by incubation with streptavidin-HRP (1:5000, M00091, GenScript) for 30 min.
-
bioRxiv - Immunology 2023Quote: ... The biotinylated SARS-CoV-2 fusion peptide (N’-biotin-DPSKPSKRSFIEDLLFNKVT-C’) and His-tagged HIV Env MPER peptide (N’-NWFDITNWLWYIKSGGSHHHHHHHH-C’) were chemically synthesized by GenScript.
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Immunology 2020Quote: ... UK) and CAR combinations with anti-CD19(fmc63) scFv were assessed by staining with Protein-L (Biotin-Protein L, GenScript, Piscataway, NJ, USA). In both cases ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...