Labshake search
Citations for GenScript :
101 - 150 of 518 citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... GGGK-FITC (Isogen Life Science) was used for C6-LPETGG-His and GGGK-azide (Genscript) for C9-LPETGG-His ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript). To express and isolate recombinant TcsL ...
-
bioRxiv - Biochemistry 2022Quote: ... for >5 min at room temperature and incubated with mouse anti-His antibody (Genscript A00186) at 0.1 µg/ml in EveryBlot buffer for 1 hr at room temperature or overnight at 4 °C ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Biochemistry 2023Quote: A pET-24 a (+) vector containing each codon optimized His-tagged sequence was ordered (Genscript) and transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Biophysics 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Bioengineering 2021Quote: Codon-optimized genes for bivalent VHH-Fcs were synthesized and cloned into pTT5 (GenScript; Piscataway ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The sequences containing 7F9-Fc cDNA were custom synthesized and ligated into pUC57 (GenScript). Plasmids containing 7F9-Fc were transformed into Invitrogen Top10F competent cells (Thermo #C303003 ...
-
bioRxiv - Immunology 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Immunology 2021Quote: ... Western blot and immunoprecipitation and has sensitivity comparable to the THE™ His Tag Antibody (Genscript) in ELISA and Western Blot (Supplementary Fig.S7).
-
bioRxiv - Biophysics 2021Quote: ... This was followed by several PBS wash steps and incubation with anti-His antibody (#25B6E11, Genscript) at a dilution of 1:500 for 1h in 0.1 % FBS/PBS ...
-
bioRxiv - Biophysics 2019Quote: ... His-tagged Xenopus laevis HAUS8 was used to produce rabbit polyclonal anti-HAUS8 anti-serum (Genscript). Alexa-647 labelled XenC antibody was generated by first dialyzing antibodies in PBS buffer (50mM NaPO4 ...
-
bioRxiv - Biophysics 2019Quote: ... anti-sera were generated against His-tagged HAUS1 and C-terminal fragment HAUS6 as well (Genscript). All custom-made antibodies were purified from serum with an antigen-coupled matrix (Affi-Gel 10 or 15 ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: AngII and TRV023 (Sar-Arg-Val-Tyr-Lys-His-Pro-Ala-OH) were synthesized by GenScript USA (Piscataway ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2023Quote: ... The construct CZA97.012 SOSIP.664 with His-tag (GSGSGGSGHHHHHHHH) was cloned into the pPPI4 expression vector (GenScript). HEK-293F cells were transiently transfected by the use of 293fectin (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: All HP1α tagged constructs with a 6x-His tag on the N-terminus were ordered from Genscript. Rosetta competent cells (Millipore Sigma 70954 ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... All purification steps were monitored either by Coomassie-stained SDS-PAGE or anti-HIS western blot (Genscript #A00186). HMT assays were essentially performed as described in (Frapporti et al. ...
-
bioRxiv - Cell Biology 2021Quote: N-terminally Histidine (His)-tagged Bin1b SH3 from zebrafish was cloned into pET-28a (+) expression vector (GenScript®). Full length zebrafish Cavin4a (Cavin4a-FL ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... and then incubated with 45 μL each of 0.1 μg/mL of THE anti-his-HRP (GenScript, A00612) in PBST/BSA for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Microbiology 2021Quote: ... ECD or those with desired ACE2 mutations were fused to the codon-optimized synthetic IgG1 Fc (GenScript) in which GASDALIE or LALA mutations were incorporated ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.04-0.32 picomoles of Tspan12-1D4 and 0.25-2 picomoles of 7xHis-MSP1D1 were probed by Rho anti-1D4 and THE anti-His (GenScript) antibodies respectively ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid encoded an N-terminal 8X His-SUMO-tagged hNatD in the pET-21a vector was obtained from Genscript. Library of Pharmaceutically Active Compounds (LOPAC ...
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...