Labshake search
Citations for GenScript :
51 - 100 of 266 citations for Somatostatin 28 Rabbit Polyclonal since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... His-tagged Xenopus laevis HAUS8 was used to produce rabbit polyclonal anti-HAUS8 anti-serum (Genscript). Alexa-647 labelled XenC antibody was generated by first dialyzing antibodies in PBS buffer (50mM NaPO4 ...
-
bioRxiv - Microbiology 2023Quote: ... and a rabbit polyclonal antibody against the full-length PRV VP16 that was ordered from Genscript. Anti-cJun and anti-phospho-cJun (Ser63 ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane was blotted with anti-ChmA (dilution = 1:500; custom polyclonal rabbit antibody generated by GenScript), anti-PicA (dilution = 1:1,000 ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were incubated with 1 µg/ml of a custom-made MMP13 rabbit polyclonal primary antibody (GenScript, Piscataway ...
-
bioRxiv - Microbiology 2023Quote: ... gH was detected using custom-made polyclonal rabbit antibodies raised against peptides derived from KSHV gH (Genscript).
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Blots were first incubated with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) at a dilution of 1:1000 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we used custom polyclonal antibodies raised against recombinant fragment antigens generated by rabbits’ immunization (GenScript, Piscataway Township, NJ, USA). Each recombinant fragment was injected into three rabbits ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The next morning the buffer was replaced with 10 ml new TBST (2.5% milk) and primary antibody added (polyclonal rabbit antibodies ordered from GenScript). The antibody used for each blot is indicated in the figure ...
-
bioRxiv - Microbiology 2023Quote: ... which was detected using an affinity-purified rabbit polyclonal anti-ORF59 antibody that was generated (GenScript, Piscataway, NJ, USA) against the peptides GKKTRGGNKASDSGT and KRPPPKKDREPTTKRPKL ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit polyclonal antibody to Drosophila Rab6 3’UTR was acquired by immunizing the New Zealand rabbit with peptide NRLSRRSNHPLPLFC by GenScript company (Nanjing) ...
-
bioRxiv - Physiology 2021Quote: ... whereas the β-subunit of VHA was immunodetected using a custom-made polyclonal rabbit antibody (epitope: AREEVPGRRGFPGYC; GenScript, Piscataway, USA). These antibodies have been previously used in the inner ear of the Pacific chub mackerel (Scomber japonicus ...
-
bioRxiv - Immunology 2022Quote: ... This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript) ...
-
bioRxiv - Neuroscience 2023Quote: ... FOLR1 was immunoprecipitated by overnight incubation of lysates with rabbit anti-Xenopus laevis FOLR1 polyclonal affinity purified antibody raised against the peptide KHQKVDPGPEDDLHC (custom made by GenScript), chemically cross-linked to protein G-agarose beads at 4°C on a mini-rotator ...
-
bioRxiv - Cancer Biology 2023Quote: Capture antibodies: affinity purified rabbit anti-L1 (anti-ORF1p or anti-ORF2p (RT fragment)) polyclonal antibodies were ordered from GenScript (Custom Polyclonal Antibody Production Service) ...
-
bioRxiv - Neuroscience 2023Quote: Custom rabbit polyclonal antibodies recognising CG2233 were generated using PolyExpressTM Premium antigen-specific affinity purified pAb package provided by GenScript. Antibodies were generated against recombinant CG2233 that lacks its N-terminal signal sequence (MFSINAVILGILVTSVMA ...
-
bioRxiv - Neuroscience 2020Quote: Goat polyclonal anti-GAPDH (GenScript), chicken polyclonal anti-MAP2 (EnCor Biotech ...
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... custom polyclonal antibodies were generated in rabbits against recombinant fragments corresponding to regions that significantly differ between the two AGOs (GenScript, USA).
-
bioRxiv - Neuroscience 2022Quote: ... ASAP4b was cloned into the pJFRC7-20XUAS vector (28) using standard molecular cloning methods (GenScript Biotech), and then inserted into the attP40 phiC31 landing site by injection of fertilized embryos (BestGene) ...
-
bioRxiv - Biochemistry 2021Quote: ... anbluf65 and anbluf85 coding sequences were directly synthesized and subcloned into pET 28 a(+) (Genscript, USA). Thus ...
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Microbiology 2020Quote: ... and a custom-made rabbit polyclonal antibody against the NP of influenza D/bovine/Oklahoma/660/2013 strain (Genscript, Piscataway, NJ, USA) were used ...
-
bioRxiv - Molecular Biology 2019Quote: ... The anti-Apl polyclonal antibody was generated in a rabbit against the KLH-conjugated Apl peptide ASEIAIIKVPAPIVC by Genscript (New Jersey, USA).
-
bioRxiv - Physiology 2023Quote: ... VHA was immunodetected using custom-made rabbit polyclonal antibodies against a highly conserved epitope within subunit B (epitope: AREEVPGRRGFPGY; GenScript, Piscataway, USA). Both NKA and VHA antibodies have been validated in the inner ear of splitnose rockfish (24 ...
-
bioRxiv - Microbiology 2021Quote: ... cell cultures were stained with a custom-generated rabbit polyclonal antibody directed against the NP of the prototypic D/bovine/Oklahoma/660/2013 strain (Genscript, Piscataway, NJ, USA) [18] ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1 μg of POR-WT and mutant membrane proteins were separated on an SDS-PAGE gel and blotted on to polyvinyl difluoride (PVDF) membranes to probe with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) as described previously [43] ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were then incubated overnight at 4 °C in PBST with polyclonal rabbit antibodies raised against mcrA (1:10000 dilution) (GenScript, Piscataway, NJ, USA), washed four times for five minutes in PBST ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The epitopes used for each immunization are listed below.
-
bioRxiv - Neuroscience 2019Quote: The polyclonal DIPγ antibody was generated by Genscript in guinea pigs using the following epitope ...
-
bioRxiv - Plant Biology 2021Quote: ... goat polyclonal anti-HA (GenScript, cat. no. A00168), rabbit polyclonal anti-GFP (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... Polyclonal serum against Gn was raised commercially (GenScript) by immunisation of rabbits with a synthetic peptide (Gn residues 99–112 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: Polyclonal antibodies against PTP7 were generated by Genscript. Briefly ...
-
bioRxiv - Developmental Biology 2023Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The protein sequences used for each immunization were as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Microbiology 2020Quote: ... Primary polyclonal antibodies for Cfp29 were generated by GenScript USA Inc via immunization of rabbits with three peptides from the protein sequence ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-HA goat polyclonal antibody (GenScript, A00168-40). The secondary antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... and polyclonal anti-histone H3 (A01502, GenScript, Piscataway, NJ). After washing three times with TBST buffer ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...