Labshake search
Citations for GenScript :
1 - 50 of 156 citations for Soluble Starch Synthase Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ATP synthase ORF clones were purchased from GenScript USA Inc (Piscataway ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Biochemistry 2020Quote: ... Soluble protein was further purified via glutathione agarose chromatography (GenScript # L00206) with gravity flow at room temperature in fresh buffer B ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg soluble AdpgkMut (ASMTNMELM) or AH1 (SPSYVYHQF) peptide (GenScript) with 50 μg poly(I:C ...
-
bioRxiv - Cell Biology 2024Quote: ... the soluble fraction was incubated with gluthatione agarose beads (L00206: GenScript) for 2H ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The sialic acid synthase protein (NCBI accession # XP_021429200) was commercially produced using the insect expression vector pFastBac1 (GenScript U488UFB180).
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble fraction was bound to anti-DYKDDDDK resin (Genscript, Piscataway, NJ) for 1 h at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A custom-made antibody directed against peptide CKVGEPRGVSPEDMG of the sialic acid synthase (NCBI accession # XP_021429200) was purchased (GenScript U881EER070) and used at a dilution of 1/2000 ...
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.
-
bioRxiv - Physiology 2022Quote: ... and incubated with a custom polyclonal primary antibody against coral soluble adenylyl cyclase (sAC; GenScript). This antibody was designed against sAC expressed by the coral Acropora digitifera (Barott et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Microbiology 2020Quote: ... The remnant endotoxin was identified with ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript) and no more than 0.1 EU/mL of endotoxin was detected.
-
bioRxiv - Cell Biology 2019Quote: ... quantified using a chromogenic limulus amebocyte lysate endotoxin assay kit (GenScript, Piscataway, NJ), were significantly below those necessary for activation of TLR4 (typically <0.05 ng/ml).
-
bioRxiv - Immunology 2023Quote: ... Endotoxin levels were measured using the ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... and contaminants were removed by Toxin Sensor Chromogenic LAL Endotoxin Assay Kit (GenScript, L00350). Purified proteins were concentrated and filtered using Amicon ultra filter units – 30k NMWL (MilliporeSigma ...
-
bioRxiv - Immunology 2020Quote: ... Endotoxin concentration was determined using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript, NJ). All protein used for immunization had final endotoxin levels below 10 EU/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting lysate was centrifuged at 12,000 x g to separate the soluble protein fraction and incubated with glutathione resin (GenScript) for 30 minutes while shaking at room temperature (RT) ...
-
bioRxiv - Bioengineering 2019Quote: Endotoxin amounts were tested using the ToxinSensor chromogenic LAL endotoxin assay kit (GenScript, Piscataway, NJ) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and checked for endotoxins levels using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript).
-
bioRxiv - Bioengineering 2020Quote: ... Polymers were evaluated for endotoxin using a Chromogenic LAL Endotoxin Assay Kit (GenScript, Nanjing, China).
-
bioRxiv - Biochemistry 2021Quote: The codon-optimized gene encoding for the N-terminal soluble domain of Bacteroides fragilis FeoAB (BfNFeoAB; Uniprot identifier A0A0K6BRR9) was commercially synthesized by GenScript. The pET-21a(+ ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Immunology 2019Quote: ... omentum culture supernatants and peritoneal lavage fluid using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (GenScript) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Microbiology 2021Quote: ... and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript) to make sure <1 EU/ml ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Biophysics 2023Quote: Endotoxin levels of purified samples were determined using a ToxinSensor chromogenic LAL endotoxin assay kit (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Neuroscience 2023Quote: ... and then tested post-treatment for endotoxin levels using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript). Endotoxin levels of tau were < 0.1 EU/mL at working concentrations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Serum LPS concentrations were measured with a ToxinSensor Chromogenic Limulus Amebocyte Lysate (LAL) Endotoxin Assay Kit (GenScript, Piscataway, NJ), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and endotoxin contamination was tested using a ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA; L00350). All cultures were maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... Endotoxin levels in all preparations were measured using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, Piscataway, NJ, USA) and were less than 0.05 EU/ml.
-
bioRxiv - Immunology 2022Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... followed with the measurement of the level of endotoxin by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Biotech Corp., USA). The recombinant α-syn solution was aliquoted before fibrillization and stored at −80°C until use ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Bioengineering 2024Quote: ... the endotoxin levels in OVA-ZE and pZR-ELP were quantified by ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript). OVA-ZE and pZR-ELP with low endotoxin levels and endotoxin free water and PBS were used to prepare OVA protein vesicles for in vitro and in vivo studies ...
-
bioRxiv - Immunology 2024Quote: The concentration of endotoxin in CXCL4 stock solutions was measured by Chromogenic LAL Endotoxin Assay Kit (GenScript, cat. No: L00350C) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... All proteins were tested for size distribution and purity by gel electrophoresis (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and were confirmed for low endotoxin using ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript). Unfractionated heparin (UFH ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant proteins and Ov-ES products were evaluated for the presence of lipopolysaccharide (LPS) using a chromogenic LAL endotoxin assay kit (GenScript, Piscataway, NJ, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The sVNT assay uses cPass™ technology (Genscript) and detects total neutralizing antibodies measured as percent inhibition17 ...