Labshake search
Citations for GenScript :
1 - 50 of 84 citations for Sodium 40 wt. % dispersion in oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... and pBAD33mut-LTR-III WT and pBAD33mut-PARP-1 WT vectors were synthesized and cloned (Genscript) into pBAD33mut vector using the SacI and SpeI restriction enzyme sites ...
-
bioRxiv - Biochemistry 2024Quote: WT-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-2/PD40693), N112C-CCNE1-3xFLAG (GenScript ...
-
bioRxiv - Neuroscience 2020Quote: ... For visualization of the DAT-WT and DAT-K619N transgenes pUASTattB-GFP-hDAT-WT and pUASTattB-GFP-hDAT-K619N constructs were generated by GenScript (Nanjing, China). The transgenes were inserted into the P[CaryP]attP2 site on the third chromosome using Phi31C transformation to ensure equal levels of expression ...
-
bioRxiv - Genomics 2021Quote: ... Chicken (A00729-40, GenScript).
-
bioRxiv - Biophysics 2020Quote: ... the A2AAR (WT or Q310C8.65/L225C6.27 mutant) gene (GenScript) was optimized for eukaryotic expression with an N-terminal hemagglutinin signal sequence (MKTIIALSYIFCLVFA ...
-
bioRxiv - Cell Biology 2021Quote: ... or Wt or mutated ELOF1-Flag were synthesized (Genscript) and inserted in a pLenti-CMV-puro-DEST plasmid 65 ...
-
bioRxiv - Molecular Biology 2021Quote: WT and mutant SLX4 peptides were synthetized by Genscript and resuspended in H2O ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2024Quote: ... AmSP-WT gene (UniProt: S5AE64_9ALTE) was ordered from Genscript already cloned in a pET28b vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The gene coding for BAF WT was synthetized by Genscript after codon optimisation for expression in E ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human SYK(WT) DNA was custom synthesized (GenScript) as a codon optimized form for expression in Sf9 cells ...
-
bioRxiv - Biophysics 2024Quote: ... OaPAC WT and OapAC Y6W plasmids were purchased from GenScript and both sequences were optimized using GenSmart ...
-
bioRxiv - Immunology 2021Quote: ... anti-NP (GenScript, # A01506-40), anti-γ-H2AX (ABclonal ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal (VWR GenScript A01622-40); western blot ...
-
bioRxiv - Biochemistry 2020Quote: ... and the sequences were RNNFLIQMFHYIKTSLAPLPCYVYLIEHP (Degron wt) and RNNFLIQMFHYIKTSLALPWYVYLIEHP (Degron C152W) (Genscript).
-
bioRxiv - Biochemistry 2021Quote: Peptide synthesis of WT and mutant PLN8-22 was performed by Genscript Biotech Corporation ...
-
bioRxiv - Cancer Biology 2023Quote: ... mENPP1-WT sequence was amplified from pcDNA3-mENPP1-FLAG (synthesized by Genscript) using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding WT and mutant IVDs were synthesized (GenScript or TWIST Bioscience) or generated via PCR (Supplemental Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... 1:250 (GenScript, catalog no. A01658-40), mouse anti-HA 1:500 (BioLegend ...
-
bioRxiv - Genetics 2022Quote: ... DNA plasmids co-express variant and WT KCNH2 allele were ordered from GenScript Inc (Pistcataway ...
-
bioRxiv - Biochemistry 2022Quote: ... FLAG-AR-WT-MTID or FLAG-22YtoS-MTID were subcloned from pcDNA3.1(-) (Genscript) into pLenti-CMV-MCS-GFP-SV-puro (addgene #73582 ...
-
bioRxiv - Biochemistry 2022Quote: ... The H163A mutant was generated in the background of this WT construct (GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... The WT-AGO2-GFP and NES-AGO2-GFP plasmids were generated by GenScript. A classic leucine-rich nuclear export signal (NES) ...
-
bioRxiv - Biochemistry 2023Quote: Sequences encoding mouse WT and site-mutated DAG1 were synthesized (GenScript, Piscataway, NJ) and cloned into adeno-associated virus 2/9 (AAV2/9 ...
-
bioRxiv - Cell Biology 2024Quote: ... αSyn F4A was created by mutagenesis from the parental wt αSyn plasmid (Genscript). Parental Flp-In T-Rex HEK 293 cells were cultivated in StableCellTM DMEM-high glucose (Sigma #D0819 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids encoding for TMX5-V5 WT and cysteine mutants were synthesized by Genscript in pUC57 and subcloned in pcDNA3.1(- ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal β-catenin(A01211-40; Genscript, China), rabbit polyclonal YAP1(A1002 ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Plant Biology 2021Quote: The cDNAs of WT and mutant Q-satRNAs were commercially synthesized (Genscript, Piscataway, NJ). The cDNAs were amplified (see Supplemental Table 3 for primer sequences ...
-
bioRxiv - Cancer Biology 2024Quote: The pcDNA5/FRT/TO-Myc-FEN1 WT and E359K plasmids were synthesized by Genscript and include siResistance to FEN1 exon 2 siRNA GAUGCCUCUAUGAGCAUUUAU ...
-
bioRxiv - Plant Biology 2024Quote: WT or mutated lysine 4 trimethylated H3 (1-20aa) peptides were synthesized by GenScript Biotech Corporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... doxycycline-inducible expression of WT and mutant mouse Ctcf cDNA were obtained from GenScript in pUC19 vectors ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified TopBP1b6-8 WT and W1145R were digested with PreScission 3C enzyme (GenScript, Z03092-500) for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA encoding C-terminally His6-tagged WT and truncated versions of SH Mumps (GenScript, Netherlands) in the pXOOM expression vector (55) ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-HA goat polyclonal antibody (GenScript, A00168-40). The secondary antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ACTA1 (Catalog # A00885-40, GenScript, dilution 1:500) antibodies were used for protein detection ...
-
bioRxiv - Immunology 2021Quote: ... Mutation of the STAT3 binding site (wt: TTTCCAAGCAC, mut: TGGAAGGGCAC) in CENSER was performed commercially (GenScript). CENSER and proximal deletion constructs were done using the QuikChange mutagenesis kit (Agilent) ...
-
bioRxiv - Genomics 2022Quote: ... we synthesized a 170 bp sequence containing the WT CDC20 promoter sequence (chr1:43,824,464-43,824,633) (GenScript). From this template ...
-
bioRxiv - Biochemistry 2024Quote: ... ovatus CP926 PL38 WT and mutants without signal peptide were purchased from GenScript (Piscataway, NJ, USA) and cloned into pET28a(+ ...
-
bioRxiv - Microbiology 2023Quote: The codon-optimized sequence coding for the wild type (WT) N (stain Long) was syn-thetised (GenScript) and cloned in the pFastBac Dual vector under the control of the polyhedrin promoter at BamHI and SalI sites ...
-
bioRxiv - Microbiology 2023Quote: ... For LAI WT each flask was transfected with 2.5 μg of VSV-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg pLAIΔEnvGFP (Suppl ...
-
bioRxiv - Biochemistry 2022Quote: Constructs to express FLAG-MTID or its fusions to AR WT and 22YtoS fusion proteins were synthesized by Genscript and either cloned into pcDNA3.1(- ...
-
bioRxiv - Molecular Biology 2024Quote: ... competent cells were transformed with 50 ng of pGEX-4T-1-GST-TEV.TZF-WT or the TZF-NLSmut derivative which were synthesized by Genscript. The constructs contained TTP TZF domain (amino acids 93-165 ...
-
bioRxiv - Bioengineering 2024Quote: ... Stiff elastic (50 kPa) NorHA hydrogel precursor solutions (5 wt% NorHA) containing 1 mM thiolated RGD peptide (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a rabbit polyclonal antibody specific for calmodulin-binding peptide (A00635-40, GenScript), a Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... and a mouse monoclonal antibody to detect GAPDH (clone 3B1E9, GenScript A01622–40) were used at a dilution of 1:1,000 in blocking buffer ...
-
bioRxiv - Cancer Biology 2021Quote: Codon-optimized cDNAs encoding N-terminal HA or Flag-tagged WT PEAK3 and HA-tagged PEAK3 mutants were synthesized by Genscript and cloned into the EcoRI restriction sites of the pMIG-GFP Express vector.
-
bioRxiv - Microbiology 2020Quote: Synthetic gene construct and the corresponding site-specific mutants for WT SadP(125-328) type PN were obtained from Genscript. Site-specific mutants constructed were Δ244-246 (PSAD-1) ...
-
bioRxiv - Microbiology 2021Quote: ... coli K-12 MG1655 thymidylate kinase alleles (WT, Q45P, and A69T) were amplified and cloned into the plasmid expression vector pRSFDuet-1 (GenScript). Expression is under control of the T7 lac promoter ...