Labshake search
Citations for GenScript :
451 - 500 of 725 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then eluted with a single wash of gel filtration buffer supplemented with 150 μg/mL 3x-Flag peptide (Genscript cat. RP21087) and 20 μM GppNHP ...
-
bioRxiv - Immunology 2023Quote: ... Insoluble material was removed by centrifugation at 30,000 × g for 30 min and the supernatant was incubated with anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ). After that ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Western blot membranes were probed with primary antibody (either 1:4000 rabbit anti-FLAG [Sigma Aldrich, St. Louis MO] or 1:4000 mouse anti-StrepII [Genscript, Piscataway NJ]) for 1 hour at room temperature or overnight at 4°C and with secondary antibody (either 1:5000 goat anti-rabbit or anti-mouse respectively conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Molecular Biology 2022Quote: ... the column was washed three times with gel filtration buffer supplemented with 150 μg/mL 3x-Flag peptide (Genscript cat. RP21087, Supplementary Figure 1A).
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Developmental Biology 2020Quote: Dual-tagged Slit2 was designed using the human Slit2 sequence (NM_001289135.2) and ordered from Genscript Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...