Labshake search
Citations for GenScript :
251 - 300 of 496 citations for Recombinant TBAUK1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Microbiology 2019Quote: ... The blot was washed and secondary antibody (for Ryp proteins: Goat α-rabbit HRP (GenScript) 1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Plant Biology 2021Quote: ... Accumulation of FHT-HA protein was assayed by immunoblot with a monoclonal HA antibody (GenScript).
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Cell Biology 2020Quote: Our RAD-51 antibody was generated from a His-tagged fusion protein expressed by Genscript from plasmid pET30a containing the entire RAD-51S coding sequence (1385 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein coding sequences for PRMT1v1 (ENST00000391851.8) and PRMT1v2 (ENST00000454376.7) were ordered from GenScript (https://www.genscript.com) and PCR-cloned into pHIV-Luc-ZsGreen (Addgene plasmid #39196 ...
-
bioRxiv - Microbiology 2023Quote: ... the purified polyclonal antibodies against RNase E was bound to Protein A/G MagBeads (Genscript), followed by cross-linking using dimethyl pimelidate dihydrochloride (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... or 9 ug/mL of full-length FimH protein (antigen for custom antibody production, Genscript) was used.
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Neuroscience 2020Quote: ... Purified monomer protein passed through two to three rounds of endotoxin removal (Endotoxin removal kit, GenScript) to reach a level of <0.1 EU mg-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...