Labshake search
Citations for GenScript :
451 - 494 of 494 citations for Recombinant Mouse Dickkopf Homolog 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Microbiology 2021Quote: ... Monoclonal anti-CodY antibody was generated by injection of CodY into the BALB/C mouse (Genscript, USA). Mouse anti-CodY IgG monoclonal antibody (IgG ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... codon optimized mouse Pcbp2 clone with N-terminal Flag epitope tag was produced by gene synthesis (Genscript) and cloned in pcDNA3.1 (Invitrogen).
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Neuroscience 2023Quote: ... the complete open reading frame of mouse NaV1.7 was cloned into the pcDNA3.1(+)-C-DYK vector (GenScript) with several modifications ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Neuroscience 2022Quote: Mouse voltage-gated sodium channel 5934 base pair-long genes (mSCN8AWT, mSCN8AK1425TAG, and mSCN8AK1546TAG were synthetized by GenScript (mSCN8A ...
-
bioRxiv - Immunology 2022Quote: ... The cells were allowed to adhere for 24 hours prior to treatment with mouse IL11 (UniProtKB: P47873, GenScript) or mouse TGFβ1 (R&D Systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Bioengineering 2022Quote: ... (GGGS)2 and mouse IL-10 (A3-IL-10) were synthetized and subcloned into the mammalian expression vector pcDNA3.1(+) by GenScript. To enable affinity-based purification ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used in the study were mouse anti-FLAG (1:1000; Cat. No. A00187-200, Genscript, NJ, USA), chicken anti-GFP (1:2000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and C: 861TLFRQM[pS]SGAI) with numbering indicating position in mouse HCN1 were commercially synthesized (GenScript Peptide Synthesis Service). Experiments were conducted at 25 °C in PBS (pH 7.4 ...
-
bioRxiv - Neuroscience 2021Quote: VH and VL sequences were identified in Biogen Idec’s patent submission for BIIB-037 WO2014089500 A1 and were cloned into mouse IgG2a and kappa pcDNA3.1 vectors (GenScript). Murine chimeric Aducanumab (Adu ...
-
bioRxiv - Molecular Biology 2022Quote: ... Full-length mouse IMPG1 variants were synthesized and inserted in a pcDNA3.1(+)-P2A-eGFP vector under a CMV promotor by Genscript. All IMPG1 proteins were expressed in HEK293 cells ...
-
bioRxiv - Molecular Biology 2022Quote: Custom mouse monoclonal (clone 30E2-2) was raised against acetylated K164-SAE2 peptide (HP{Lys-Ac}PTQRTFPGC) by GenScript. Available on request to the corresponding author subject to completion of an M.T.A.
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times with goat anti-rabbit IgG antibody or goat anti-mouse IgG antibody (GenScript) for one hour followed by washing three times with TBST again ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: The plasmid directing expression of mouse ARL16-myc in mammalian cells was obtained by first having the open reading frame synthesized by GenScript and later using PCR to amplify this open reading frame with insertion of the C-terminal myc epitope (EQKLISEEDL ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Biophysics 2021Quote: ... to produce antibodies, peptides corresponding to mouse C2CD6 (ALS2CR11) (359-377, EKLREKPRERLERMKEEYK) (Open Biosystems) and SLCO6C1 (1-14, MAHVRNKKSDDKKA) (GenScript) were synthesized and conjugated to KLH carrier protein ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Microbiology 2020Quote: ... the fixed cells were labeled with primary antibodies including goat anti-major outer-membrane protein (MOMP; Meridian, Memphis, TN) and mouse or rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies against AFF3IR-ORF1 in mouse and against AFF3IR-ORF2 in rabbit were synthesized by GenScript (Piscataway, NJ, USA). The antibodies against Sca-1 (ab51317) ...
-
bioRxiv - Neuroscience 2024Quote: ... N-terminal-myristoylated peptides based were on based on the C-terminal sequence of the mouse NR1C2 and custom ordered from GenScript. The wildtype sequence was NQKDTVLPRRAIERE ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Immunology 2022Quote: ... The TCR variable region in combination with mouse TCR α and β constant regions was then obtained as synthetic DNA (GenScript) that was subcloned into the pMIG II vector and used for transduction36.
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of the 11 subunits of mouse CMG were codon optimised for high-level expression in budding yeast cells and produced by DNA synthesis (GenScript Biotech). A previously described ‘yeast toolkit’ (Lee et al. ...
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... In white clear bottom 96-well plates 10 μL IL-34 antibody (mouse monoclonal IgG2A (v1.1 manufactured by Genscript, Ma et al., 2012), rat monoclonal IgG2A (MAB5195 ...
-
bioRxiv - Immunology 2023Quote: ... was used as a capture antibody and rabbit polyclonal antibody raised against IL-7Rγ peptide agonist followed by a mouse anti-rabbit IgG Fc HRP (Genscript Cat# A01856-200) as a detection antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Western blot membranes were probed with primary antibody (either 1:4000 rabbit anti-FLAG [Sigma Aldrich, St. Louis MO] or 1:4000 mouse anti-StrepII [Genscript, Piscataway NJ]) for 1 hour at room temperature or overnight at 4°C and with secondary antibody (either 1:5000 goat anti-rabbit or anti-mouse respectively conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Immunology 2024Quote: ... gene over-expression studies were carried out using a mouse abcf1 construct expressed in the pcDNA 3.1 vector was purchased from GenScript (Clone Id: Omu73202; XM_006524122.2).
-
bioRxiv - Immunology 2022Quote: Twenty 15-mer peptides (Figure 1A) used in human and mouse T-cell stimulation experiments were chemically synthesized by Genscript (TFA removal, >85% purity). The peptides were dissolved in DMSO at 20 mg/mL (∼12 mM) ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...
-
bioRxiv - Neuroscience 2021Quote: ... we used a custom rabbit polyclonal anti-mouse AQP4ex (a gift from Drs Frigeri and Nicchia) generated against the peptide DSTEGRRDSLDLASC within the mouse AQP4 carboxyl terminal extension (GenScript Biotech, Piscataway, NJ, USA) that has been shown to detect the extended AQP4 isoforms 21 ...