Labshake search
Citations for GenScript :
551 - 600 of 626 citations for Recombinant Human Glypican 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding full length human systemic RNAi-defective transmembrane family member 1 (hSIDT1) was synthesized by GenScript and was then cloned into the pEG BacMam expression vector to be expressed via baculoviral transduction in HEK293S GnTI− cells as a fusion protein containing a C-terminal GFP-Strep-tag-II for large scale protein expression [49] ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Developmental Biology 2020Quote: The fraction of mouse Tbx4-lung mesenchyme specific enhancer (LME) (mm10, chr11:85,893,703-85,894,206, GenScript, ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... A synthetic gene coding for the Bacillus subtilis glmS ribozyme and PvAc-3’U was obtained from (GenScript), and cloned into the HB-PfCul2/cDDHA plasmid at XhoI/AgeI site ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: FLOE1 and derived mutant constructs for expression in human cells were optimized for human expression (Table S3) and generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA).
-
The E3 ubiquitin-protein ligase MDM2 is a novel interactor of the von Hippel-Lindau tumor suppressorbioRxiv - Biochemistry 2020Quote: ... Genes encoding the human MDM2 and pVHL30 proteins were obtained from commercial plasmid provided by GenScript (GenEZ plasmid OHu28568 and OHu23297) and cDNA transferred into pGBKT7 and pGADT7 plasmids (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs that code mature proteins of human mitochondrial ECSIT (UniProtKB-Q9BQ95) and NDUFAF1 (UniProtKB-Q9Y375) were purchased from GenScript (Piscataway, USA) as codon-optimized for E ...
-
bioRxiv - Cell Biology 2021Quote: PopZ and derived mutant constructs for expression in human cells were generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA). The mCherry-G3BP1 plasmid was a kind gift of Dr ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Genetics 2022Quote: ... PRDM9 (aa 1-416) and PRDM9dC (aa 1-371) were amplified from human cDNA purchased from GenScript (ORF Clone ID OHu03253). SETD2 (aa 1450-1645 ...
-
bioRxiv - Cell Biology 2024Quote: ... The human LEP mRNA sequence was sourced from the cDNA construct hLEP-pcDNA3.1(+)-C-(K)DYK (GenScript, clone ID OHu27387; NM_000230.3). Leptin-SBP-HaloTag plasmid was generated by inserting the WT LEP gene into the backbone derived from pMPx92 using restriction digest and Gibson assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... ANS4-GFP and bEnd.3 cells were both treated with 100nM of 43gap 26 peptide (VCYDKSFPISHVR) (Genscript, catalogue # RP20274), every 8 hr for 24 hr ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Cell Biology 2024Quote: MeHA hydrogels were formed from a 3% w/v MeHA macromer solution functionalized with 1 mM RGD peptide (GenScript) in 0.2 M Triethanolamine (TEOA ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides containing the N-loop or the C-terminal sequence of human chemokines were designed and obtained (> 75% purity) from GenScript (Hong Kong). All peptides are biotinylated (biotin-Ahx ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit polyclonal antibody to Drosophila Rab6 3’UTR was acquired by immunizing the New Zealand rabbit with peptide NRLSRRSNHPLPLFC by GenScript company (Nanjing) ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Biochemistry 2021Quote: ... The cell debris was removed by centrifuging at 16000 rpm for 30 min and the supernatant was loaded onto 3 mL of Ni-NTA resin (Genscript). A gravity flow Ni-NTA chromatography was performed ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Cell Biology 2021Quote: ... All SHIP164 (UHRF1BP1L) ORFs used in this study utilized a human codon optimized sequence designed and purchased from Genscript (sequence available upon request). The following constructs were kind gifts ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1 μg of POR-WT and mutant membrane proteins were separated on an SDS-PAGE gel and blotted on to polyvinyl difluoride (PVDF) membranes to probe with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) as described previously [43] ...