Labshake search
Citations for GenScript :
501 - 550 of 822 citations for Recombinant Human Carboxylesterase 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: The full length human KCNQ3 construct (NCBI Reference Sequence: NP_004510.1; GI:4758630) was synthesized (GenScript USA, Piscataway, NJ) and ligated between the BamHI and XbaI sites in the multiple cloning sites of into the pGEM-HE vector ...
-
bioRxiv - Immunology 2024Quote: ... the light chain immunoglobulin variable region sequences were inserted into the human kappa constant region sequence (Genbank accession number OM584289.1) and synthesised into mammalian vector pcDNA3.1 (Genscript). Human J chain was also synthesised into mammalian vector pcDNA3.1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides encoding residues 166–181 of human CHMP6 or various truncations of HCMV pUL71 were purchased from Genscript at >95% purity and the dry peptides were resuspended in ITC buffer to the desired concentration ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Biochemistry 2019Quote: Synthetic genes encoding human viperin, IRAK1 and TRAF6 (GenBank accession numbers AAL50053.1, NM145803, NM001569 respectively) were purchased from GenScript. For details see supplementary information.
-
bioRxiv - Molecular Biology 2019Quote: ... Clone OHu31338D containing the open reading frame of the human ALKBH3 in pcDNA3.1 with C-terminal FLAG tag was obtained from GenScript, U.S.A ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Biochemistry 2022Quote: The genes of the human AC isoforms 1 – 9 cloned into the expression plasmid pcDNA3.1+/C-(K)-DYK were purchased from GenScript and contained a C-terminal flag-tag ...
-
bioRxiv - Immunology 2020Quote: The construct of human iNOS oxygenase domain (1284 nucleotide) and full length NOSIP (912 nucleotide) were synthesized by GenScript and cloned in pET22b expression vector ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding human ACE2 (1-615) with a 6xHis tag at C terminus was synthesized by Genscript and cloned to the vector pCMV-IRES-puro ...
-
bioRxiv - Genetics 2022Quote: The pancreatic isoform of human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast expression and cloned into pDONR221 (Genscript). The initial test set GCK variants were generated by Genscript ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Blots were first incubated with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) at a dilution of 1:1000 ...
-
bioRxiv - Synthetic Biology 2021Quote: The human TDF HMG-box (hereinafter called TDF) was cloned into the plasmid pET-24c (+) (KanR) by GenScript (USA) using the sequence from the position 313 to 528 of the mRNA ...
-
bioRxiv - Biochemistry 2021Quote: DNA polynucleotides encoding the opsin domains optimized for human codon usage were synthesized and cloned by GenScript (Piscataway, NJ) into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: Western blotting procedures to determine the proteolytic cleavage of the HA were carried out as previously described.24,33 HEK293T cells were co-transfected with pCAGGS expression plasmids encoding for the corresponding HA and pcDNA3.1 plasmids encoding human airway proteases (Genscript). The Western blotting procedure was carried out with cell lysates ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene ...
-
bioRxiv - Microbiology 2021Quote: The human codon-optimized S gene of SARS-CoV2 (Wuhan-Hu-1 isolate, accession number MN908947.3) was obtained from GenScript. Site-directed mutagenesis was used to produce the glycan-masking S mutant genes ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1 ...
-
bioRxiv - Microbiology 2022Quote: All constructs were PCR amplified from a codon optimized gene block encoding the coding sequence of human DYRK1A (GenScript) using Q5 High-Fidelity DNA Polymerase with GC enhancer buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Cell Biology 2023Quote: ... pmCherry-N1-VAMP3 S48E pmCherry-N1-VAMP3 S48A and pEGFP-N1-WDFY2 (human) were generated as synthetic constructs (Genscript).
-
bioRxiv - Bioengineering 2023Quote: The L1 gene fragment sequences of human papillomavirus (HPV) types 16 and 18 were incorporated into the pCDNA3.1(+) plasmid by Genscript. To amplify the specific regions of interest ...
-
bioRxiv - Biochemistry 2023Quote: The DNA sequence of pancreatic human GCK (Ensembl ENST00000403799.8) was codon optimized for yeast and cloned into pDONR221 (Genscript). Selected missense variants were generated by Genscript ...
-
bioRxiv - Microbiology 2023Quote: ... HA sequence was used to construct a human codon-optimized gene which was synthesized and cloned into the BamHI and EcoRI sites of pcDNA3.1+ by GenScript. The SARS-CoV-2 spike gene (Wuhan ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Biophysics 2024Quote: The hKir2.1 cDNA gene coding the sequence of human Kir2.1 was cloned into the mammalian expression vector pMT3 containing an Ampicillin resistance gene (GenScript). Kir2.1 pathological mutants (C154Y ...
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Cancer Biology 2021Quote: ... XPA expression plasmids contain full-length human XPA (NM_000380) with the indicated mutations in the pcDNA3.1(+) backbone (GenScript custom order).
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2021Quote: ... sequences with codons optimized for expression in human cells were synthesized and cloned into pHLSec between AgeI/KpnI by Genscript. The constructs were co-transfected with Furin-encoding plasmid ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166) diluted 1:5000 in dilution solution were added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... NS3/4A expression vector was generated by subcloning a synthetic gene which was codon optimized for expression in human cells (Genscript) into the pCI plasmid ...
-
bioRxiv - Molecular Biology 2022Quote: ... The coding sequences of human UBXN1 (Uniprot identifier Q04323-1) and FAF2 (Uniprot identifier Q96CS3-1) were synthesized by GenScript Biotech ...