Labshake search
Citations for GenScript :
51 - 100 of 183 citations for Rat Histidine Rich Glycoprotein HRG ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
NVX-CoV2373 vaccine protects cynomolgus macaque upper and lower airways against SARS-CoV-2 challengebioRxiv - Immunology 2020Quote: NVX-CoV2327 was codon optimized synthetically produced from the full-length S glycoprotein gene sequence (GenBank MN908947 nucleotides 21563-25384) for expression in Spodoptera frugiperda (Sf9) cells (GenScript Piscataway, NJ, USA) as describe [1] ...
-
bioRxiv - Immunology 2022Quote: Chronic progressive EAE was induced by subcutaneous immunization of female 6- to 8-week-old C57BL/6 mice (Janvier Labs, France) with 200 µL of a Myelin Oligodendrocyte Glycoprotein solution (200 µg,MOG35-55 peptide: Genscript, New Jersey, USA) emulsified in complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Biophysics 2023Quote: ... and 10 μM rat 26RFa (GenScript) were added into the cell lysis and incubated at room temperature (RT ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-sera obtained from immunized rats (Genscript).
-
bioRxiv - Neuroscience 2021Quote: cDNA encoding rat NBCe2 was purchased from GenScript and subcloned into the oocyte expression vector pXOOM ...
-
bioRxiv - Cell Biology 2022Quote: ... rat-anti-Sasshort (1:50, GenScript USA Inc.); mAb Cq4 against crumbs (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-rat kangaroo-Kid (3μg/ml, Genscript). The anti-rat kangaroo Kid was raised against the full Kid protein translated from the coding sequence obtained from the PtK transcriptome (Udy et al. ...
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
bioRxiv - Cancer Biology 2019Quote: Custom rat anti-KRAS4A antibody was developed by Genscript using the peptide sequence CEIRQYRLKKISKEEK as antigen for immunization..
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat granulocyte colony stimulating factor (G-CSF) was purchased from GenScript Corp (Piscataway NJ ...
-
bioRxiv - Immunology 2022Quote: Immunization of Wistar rats for hybridoma generation was conducted by GenScript USA ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Immunology 2022Quote: ... The purified protein was used to immunize Wistar rats to generate a panel of monoclonal antibodies by Genscript USA ...
-
bioRxiv - Microbiology 2023Quote: The full-length genomic sequence of the LCK-3110 strain of rat HEV (Genbank MG813927.1) was artificially synthesized (Genscript). The plasmid pSP64 poly (A ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...
-
bioRxiv - Immunology 2020Quote: For the surrogate neutralization assay the cPass kit from GenScript was used (Cat ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ToxinSensor Gel Clot Endotoxin Assay Kits were purchased from GenScript. VacciGrade LPS was purchased from InvivoGen.
-
bioRxiv - Microbiology 2021Quote: ... endotoxin was removed with the ToxinEraser™ Endotoxin Removal Kit (Genscript), and the endotoxin level was measured using the ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit (Genscript ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Immunology 2020Quote: ... were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... generated using the GenCrispr sgRNA Screening Kit (L00689; Genscript Biotech Corp.), and diluted to a concentration of 4 uM ...
-
bioRxiv - Microbiology 2022Quote: ... Endotoxin levels were quantified using ToxinSensor™ Chromogenic LAL Endotoxin kit (GenScript) to ensure toxin purity.
-
bioRxiv - Neuroscience 2020Quote: ... with endotoxin levels determined using a LAL chromogenic endotoxin quantification kit (GenScript). Mouse or human α-synuclein fibrils were prepared by incubation of 7 mg ml -1 α-synuclein monomer of the same origin in phosphate-buffer saline for seven days at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...