Labshake search
Citations for GenScript :
401 - 450 of 457 citations for Rat CPS1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
bioRxiv - Microbiology 2022Quote: ... and ZIKV (GenBank accession no. NC012532, UniProt accession no. Q32ZE1) were commercially synthesized and cloned into plasmid pUC57 by GenScript Biotech ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Synthetic Biology 2022Quote: ... The designed construct was gene synthesized and cloned into the pCDF plasmid backbone using the Ncol and XhoI restriction sites added by Genscript with an alanine codon added after the first methionine in the signal peptide to ensure in-frame with the Ncol restriction site.
-
bioRxiv - Microbiology 2023Quote: ... XG014 and DXP-604 were produced by transfection of HD CHO-S cells with plasmids in a 30-ml volume (GenScript). Monoclonal IgA1 antibodies were produced in CHO cells transiently transfected with two plasmids expressing a heavy and light chain ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Knockout of β2m was performed using the pLentiCRISPR v2 CRISPR/Cas9 system37 using a pLentiCRISPR v2 plasmid encoding the β2m-targeting guide RNA (gRNA): GAGTAGCGCGAGCACAGCTA (Genscript). Lentiviral particles were packaged in HEK293T cells (ATCC ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid backbone was generated by EcoRI/HindIII restriction digestion of the K89/34 scFv originally generated to order by Genscript. These digestions were followed by heat inactivation of the enzymes by incubation at 80 °C for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid backbone was generated by EcoRI/HindIII restriction digestion of the N52A/42 scFv originally generated to order by Genscript. The second subset of scFvs were cloned into the pcDNA3.4 expression plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... or one with the GCN4 peptide (EELLSKNYHLENEVARLKK) were synthesized and subcloned into the pcDNA3.1-mGL-NLuc plasmid using BamHI-XhoI sites (GenScript, Singapore). For generating the picLg and picLg-GCN4 fragment expressing plasmids ...
-
bioRxiv - Cell Biology 2023Quote: The full length of TgREMIND DNA sequence and those of its N-terminus F-BAR and C-terminus REMIND domains were synthesized and cloned into the pGEX plasmid by GenScript using the restriction enzymes BamHI and NcoI ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmids pGEX-4T-1_CepuHY2 and pGEX-4T-1_NediHY2 were purchased as already cloned by GenScript (Piscataway, New Jersey, USA). The full list of employed constructs can be found in Supplemental Materials (Table S2).
-
bioRxiv - Biochemistry 2023Quote: ... T4-foldon trimerisation domain and ADAH11 spaced by glycine-serine linker sequences (Supplementary Table 6) was inserted into the pHEN6 plasmid (Genscript), expressed in T7 Express E ...
-
bioRxiv - Biophysics 2023Quote: ... nucleotide sequences encoding picALuc residues G23-C120 or with the GCN4 peptide were synthesized and subcloned into pcDNA3.1-mGL-NLuc plasmid using the HindIII-XhoI sites (GenScript, Singapore).
-
bioRxiv - Synthetic Biology 2024Quote: ... the T7 RNAPC (110-883 aa of T7 RNAP), and ZA/ZB fragments were synthesized and cloned into the plasmid pJM1B6 (Yuan, 2022) by GenScript Biotechnology (Nanjing ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pBY011 plasmid encoding yeast CHD1 gene under the GAL1/10 promoter was obtained from a DNASU plasmid repository and altered by GenScript, where FLAG tag and NES-NES sequences were added to the N- and C-termini of the gene ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were transiently transfected with plasmids containing receptors of interest under eukaryotic expression promoters (ASGR1 was clone OHU03658D from GenScript), then split into 96-well plates (20,000 cells per well ...
-
bioRxiv - Genetics 2023Quote: All assembly parts (consisting of fragments F1 to F12 designed in the previous protocol with appended Type IIS cut sites) were ordered as plasmids in a pUC57-mini BsaI-Free backbone from Genscript at a maxiprep scale (Supplementary Table 2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
bioRxiv - Microbiology 2024Quote: ... lentiviruses were generated in HEK293T cells by transfection of pLentiCRISPRv2 -Puro plasmid containing a single guide RNA (sgRNA) (GTACTGTAGATGGTGCTCAT) (GenScript) targeting ACE2 ...
-
bioRxiv - Neuroscience 2024Quote: ... New constructs were commercially synthesized and subcloned into either the pCA LNL or pCig2 plasmid backbones by GenScript (Piscataway, NJ). Subsequent exchange of expression vectors between pCig2 and pCA LNL and other subcloning were performed in house using standard procedures ...
-
bioRxiv - Cancer Biology 2024Quote: ... which were kindly provided by Professor Yu Zhang at National Institute of Biological Sciences as gifts (the sgPTPRN2 plasmid was further cloned by GenScript), were simultaneously transfected with Lipo3000 transfection reagent (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Cell Biology 2020Quote: ... AAV production protocols were modified to include polyethylenimine co-transfection of an AAP-6 expression plasmid (ORF under the control of the CMV promoter, synthesized by GenScript Biotech), the variant 5 AAV cap plasmid ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasmid pcDNA3-PLpro-flipGFP-T2A-mCherry was constructed from pcDNA3-TEV-flipGFP-T2A-mCherry.15 SARS-CoV-2 PLpro expression plasmid pcDNA3.1-SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... the cDNA for PbChiB2 (Fig. S1) and PbChiB4 (Fig. S1) without the signal peptide was synthesized and cloned into plasmid pET-14b (GenScript, USA). Plasmids were used to transform E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length S genes of SARS-COV-2 variants (using D614G as the base plasmid) were cloned into pCDNA3.1(+) (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was directly amplified from a plasmid containing a codon-optimized version of klp-7 (klp-7_co synthetic gene) synthesized from GenScript (Table S5).
-
bioRxiv - Biochemistry 2022Quote: ... The ORF2 and ORF1 constructs were cloned into the pFastBac Dual plasmid which was used to generate baculoviruses (Genscript and Medigen). To express the ORF1 proteins ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... N-terminal 6xHis-Flag-tagged SUMO2 was cloned into BamH1 and Xho1 restriction sites of pcDNA5/FRT/TO plasmid by gene synthesis (GenScript Biotech). All primers used for site-directed mutagenesis are listed in supplementary table 1.
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Biophysics 2023Quote: ... A codon optimized gene sequence of picALuc generated using the previously described amino acid sequence30 was synthesized and subcloned into the pcDNA3.1-mGL-NLuc plasmid (generated by synthesizing the mGL gene and subcloned into the previously described pmNG-Mpro-Nter-auto-NLuc plasmid using EcoRI-BamHI sites) using BamHI and XhoI restriction enzyme sites (GenScript, Singapore) to generate the pcDNA3.1-mGL-picALuc plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 spikes or their N-to-Q or N-to-A substituted variants were codon optimized and cloned into pcDNA3.1(+) plasmid (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Neuroscience 2023Quote: ... GST-α-syn 96-140 Scr and GST-α-syn 96-110 Scr plasmids were synthesized by GenScript (Piscataway, NJ, USA). All constructs were verified by sequencing.
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments with wild type or mutation MTB DNA sequences were synthesized and cloned into pUC19 plasmid by GenScript (Figure 2). Concentrations of these plasmids are quantified by Bio-Rad ddPCR platform following the user guide ...
-
bioRxiv - Biochemistry 2021Quote: ... the MERS-S gene in the antigenomic plasmid pVSV*ΔG(MERS-S) was replaced by a modified SARS-CoV-2 spike gene (Genscript, Piscattaway, USA) taking advantage of the flanking MluI and BstEII endonuclease restriction sites ...
-
bioRxiv - Biophysics 2019Quote: ... pET21 vectors containing the inserted sequences for CsgF fused to the plasmid-encoded C-terminal hexahistidine tag were obtained from Genscript (Piscataway, NJ). E ...
-
bioRxiv - Cancer Biology 2020Quote: The ORFeome library was then generated via insert synthesis and cloning of unique plasmid inserts consisting unique barcodes (Supplementary Table 22) by a commercial vendor (GenScript, Piscataway, NJ) in arrayed barcoded tube format ...
-
bioRxiv - Biochemistry 2022Quote: ... of the human CRX protein was fused to a 6x His-tag inserted following the met start codon and subcloned into the commercial PMAL-c5x expression plasmid containing a maltose binding domain (MBD) coding sequence using Xmnl and EcoR1 restriction sites (GenScript, Piscataway, NJ). CRX DBD-MBD plasmid was transformed into BL21 E ...
-
bioRxiv - Microbiology 2022Quote: ... codon optimized genes encoding each PcaLOOL were obtained as subcloned in pPICZαA plasmids with a C-terminal 6 x His tag (GenScript, Piscataway, NJ, USA). P ...